ID: 1016644295

View in Genome Browser
Species Human (GRCh38)
Location 6:146387478-146387500
Sequence GTTTTAAGCAAAATAAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016644295 Original CRISPR GTTTTAAGCAAAATAAAAGC CGG (reversed) Intronic
901618127 1:10558306-10558328 GTCTTAAGAAATATACAAGCAGG - Intronic
902291156 1:15436066-15436088 TTTTTAAGAAAGATAAAAGTGGG - Intergenic
903271967 1:22194911-22194933 TTTTTAAACAAACTATAAGCTGG - Intergenic
903452420 1:23463343-23463365 GATTTAAGCTAAAGAAATGCAGG + Intronic
903524252 1:23980746-23980768 ATTTAAGGCAAAATAAAAGCAGG - Intronic
905064531 1:35169182-35169204 CTTTTAAGAAATATAAAAGGAGG + Intergenic
906847920 1:49214391-49214413 GTCTGAGGCTAAATAAAAGCAGG + Intronic
907139986 1:52177748-52177770 GTTTTAAGCAGAGGAAAACCTGG + Intronic
908667316 1:66507853-66507875 TTTTAAAGGCAAATAAAAGCGGG - Intergenic
909141695 1:71875253-71875275 GTTTCAAGAAAAATAAATCCTGG + Intronic
909464397 1:75957160-75957182 GTCTGAACCAACATAAAAGCAGG + Intergenic
910376753 1:86580922-86580944 GTTTATATCAAAATAAAATCAGG - Intergenic
910584152 1:88860939-88860961 GTATTAAGCAAGAGAAAAACCGG + Intronic
911060711 1:93745462-93745484 GTTTTATGCAAATTAAAGGTGGG + Intronic
911406043 1:97440884-97440906 TTTTCAAGCACAATAAAAGGAGG - Intronic
911407390 1:97460140-97460162 TTATTAAGCAGAAAAAAAGCAGG + Intronic
912157192 1:106935792-106935814 GTTTGAAAAAAAAAAAAAGCAGG + Intergenic
912578528 1:110698647-110698669 TATTTAAGTAAAATAAAAGAAGG + Intergenic
913391387 1:118316812-118316834 TTTTTAAACAAAATGAGAGCTGG - Intergenic
913402529 1:118452077-118452099 GTGTTAACCAAAAAAAAATCTGG + Intergenic
913512703 1:119576191-119576213 ATAGTAAGCAAAAAAAAAGCAGG + Intergenic
914685102 1:149971378-149971400 GTTATAAAGAAAATTAAAGCAGG - Intronic
915362122 1:155292333-155292355 TCTTTAAGAAATATAAAAGCTGG + Intronic
915461291 1:156072145-156072167 TTCAAAAGCAAAATAAAAGCGGG - Exonic
915781305 1:158553642-158553664 GTTTTATGTTAAATAAGAGCAGG - Intergenic
917081767 1:171262932-171262954 GTTTTAAGGAAATTAAAAGAAGG + Intronic
917362945 1:174196986-174197008 GATTTAAGAAAAATGAAAGGTGG + Intronic
917781980 1:178407690-178407712 GTCTCAAGCAGAATTAAAGCAGG + Intronic
918419705 1:184351994-184352016 GATTTAAGGAAAATAAAAAGTGG - Intergenic
918450938 1:184657367-184657389 GGTTTAAGCAAAATGAAAAGAGG - Intergenic
918875280 1:190033312-190033334 ATTTTAAGAAAAATGAAAGAAGG - Intergenic
919146535 1:193643215-193643237 ATGGAAAGCAAAATAAAAGCAGG - Intergenic
919424550 1:197413531-197413553 TTGTAAAGCAAAATAAAATCAGG + Intronic
919499717 1:198322457-198322479 GTATTAAGTAAAATAAAAAATGG - Intergenic
919547163 1:198938389-198938411 GTGTTATGCAAAATAAATGAAGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920736565 1:208538145-208538167 GTTCTAAGGAAAATATTAGCTGG + Intergenic
921801001 1:219402066-219402088 TTATTATGCAAAGTAAAAGCTGG + Intergenic
921995531 1:221413883-221413905 ATTTTAAAAAAAATAAAAACTGG - Intergenic
922044660 1:221932882-221932904 ATTATAAGTAAAAGAAAAGCTGG + Intergenic
922245648 1:223794685-223794707 GTTTTAAACATAAGAAAAGAAGG - Intronic
922690884 1:227689488-227689510 TTTCTCAGCAAAATAAAAGGTGG + Intergenic
922940595 1:229461658-229461680 GATTCAAGCAACATAAAAGCAGG + Intronic
922957571 1:229616499-229616521 GTTTAAAGAAAAATAAGACCAGG - Intronic
923936835 1:238770947-238770969 GTCTCAAGAAAAATAAAAGGAGG - Intergenic
924097449 1:240567806-240567828 ATTTAAATAAAAATAAAAGCAGG + Intronic
924715800 1:246572732-246572754 TTTTTTAGAAAAATAGAAGCAGG + Intronic
1062872424 10:917393-917415 GTTTTAAGTTCAATAAAAACCGG + Intronic
1063696551 10:8341148-8341170 GTTTTGGGCAAAAGAAAATCAGG - Intergenic
1064238478 10:13601363-13601385 CTTTTAAGTAAAATAATAGTTGG - Intronic
1064385925 10:14891416-14891438 TTTTTAAGCAAAATAACAACAGG + Intronic
1065675803 10:28173055-28173077 CTTTTAAATAAAATATAAGCCGG + Intronic
1066566554 10:36727368-36727390 TTTTTAAGAATAATAAAATCTGG - Intergenic
1067855412 10:49788470-49788492 TCTTTAAGAGAAATAAAAGCCGG + Intergenic
1068415541 10:56716784-56716806 GTTTTAAGCCAAAATAAAACTGG - Intergenic
1068467396 10:57412515-57412537 GTTTGAAGAAAAATAATAACAGG - Intergenic
1069285973 10:66715602-66715624 GTTTTTAGATAACTAAAAGCTGG + Intronic
1070234216 10:74607054-74607076 GTGGAAAGCAAAAAAAAAGCAGG - Intronic
1070515048 10:77197271-77197293 GATCTAAGCAAAATCAAATCAGG + Intronic
1071324712 10:84501712-84501734 GTTTAAAAAAAAAAAAAAGCAGG - Intronic
1072107276 10:92286233-92286255 ATATTTAGAAAAATAAAAGCAGG - Intronic
1073390140 10:103168760-103168782 ATATTAAGCAAGAAAAAAGCTGG + Intronic
1073399610 10:103245922-103245944 GTTTTAAAAAAAAAAAAAGTGGG + Exonic
1073495740 10:103889359-103889381 GGTTAAAACAAAAAAAAAGCTGG + Intronic
1074060371 10:109959970-109959992 GATTTTAGAGAAATAAAAGCAGG - Intergenic
1074150702 10:110757165-110757187 TTAGAAAGCAAAATAAAAGCAGG - Intronic
1074353911 10:112764434-112764456 GGTTTAAGCAAAATATAACTAGG - Intronic
1074470603 10:113723198-113723220 GTTTTAAAAAAAAAAAAAGATGG - Intronic
1074487932 10:113906530-113906552 GTTTTAAGCCAAAAAAAAAAAGG + Intronic
1075212236 10:120501021-120501043 GTTATAAGAAAAATAATAGCAGG + Intronic
1075259575 10:120950726-120950748 TTTTTAAATAAAAAAAAAGCAGG + Intergenic
1078589259 11:12624502-12624524 TTGTTAAGGAAAATAAAAGAAGG + Intergenic
1078630141 11:12995166-12995188 GTTCTAAGTAACAGAAAAGCTGG + Intergenic
1078788663 11:14521487-14521509 GTTTCAAAAAAAAAAAAAGCCGG + Intronic
1079510615 11:21205710-21205732 GTATTAAGAAAAATATAAACTGG - Intronic
1081589916 11:44415019-44415041 GTTTCCAGCAAATAAAAAGCAGG + Intergenic
1081865107 11:46355402-46355424 GTTTTAAGAAAGAAAATAGCCGG - Intronic
1083104539 11:60345343-60345365 GAATTAAGCAAAATAAAGGTAGG - Intronic
1083243649 11:61408862-61408884 TTTTGAAGCAAAATGAAAGCAGG - Intronic
1083465688 11:62844373-62844395 GTATTAAATAAAATAAAAGTAGG - Intergenic
1083848912 11:65354327-65354349 GCTTTAAGCCACACAAAAGCTGG - Intergenic
1084770120 11:71337216-71337238 GTTGTAAGCAAGAGAAAAACAGG - Intergenic
1085538637 11:77244665-77244687 TTTTTAAATAAAATAGAAGCAGG - Intronic
1085968660 11:81560094-81560116 ATTTTAAGTAAAATAAAAAGTGG + Intergenic
1086731208 11:90251759-90251781 GTTCTAAGCAAAGGAATAGCAGG + Intergenic
1086853219 11:91836201-91836223 GTTTTAGGTAAAAAATAAGCAGG + Intergenic
1088093460 11:106071138-106071160 GTTTTGAGCAAGAAGAAAGCTGG - Intronic
1088687265 11:112295591-112295613 TTTTTAAGTAAAATAAAATCAGG - Intergenic
1089110528 11:116052366-116052388 GTATAAAGCAAAACAACAGCAGG + Intergenic
1089825924 11:121277278-121277300 GTTTTAATCAAAAGCAATGCTGG + Intergenic
1091096821 11:132831017-132831039 GTTATAAGAAAAAAAAAAGCAGG - Intronic
1092022407 12:5213350-5213372 GTTTTGAGAAGAATAAAAACTGG - Intergenic
1092174368 12:6393000-6393022 TTTTTCAACAAAATAAAAGGAGG + Intergenic
1093330430 12:17830464-17830486 ATGTTAAGAAAAATAAAAGTTGG + Intergenic
1093685388 12:22048267-22048289 TTTTTAAGAAAAAGTAAAGCAGG + Intronic
1093820292 12:23608296-23608318 GTTTTAAGCAATAGAAAGACTGG - Intronic
1095126377 12:38482922-38482944 GATTTTAGCAAAATAAAGGTAGG + Intergenic
1096880601 12:54665964-54665986 AACTTAAGCAAAAGAAAAGCAGG + Intergenic
1097017295 12:55996654-55996676 TTTCTACGCAAAATAAAAGACGG + Exonic
1097354067 12:58581854-58581876 TTTTTTAGAAAAATAAATGCTGG - Intronic
1098030390 12:66247723-66247745 ATCTTCAGCAAAATACAAGCTGG - Exonic
1098392969 12:69988930-69988952 ATTTTAAACAAAATAAACCCCGG - Intergenic
1098478337 12:70932370-70932392 GTTCTAATAAAAACAAAAGCAGG - Intergenic
1099356290 12:81639264-81639286 GTTTTAAAAGAAAAAAAAGCAGG - Intronic
1099623770 12:85039692-85039714 GTTTTTAGTTAAATAAAAGCAGG + Intronic
1099836615 12:87914734-87914756 TTTTTAAGAAAAAAAAAAGGAGG - Intergenic
1100294842 12:93251170-93251192 GGTTTAAGCAAATTAAAAAAGGG - Intergenic
1100908275 12:99327670-99327692 TTTTCAAGCAAAATAAAAGTCGG + Intronic
1101906298 12:108829029-108829051 GGTTTAAGAAAAGTAAAAACTGG + Intronic
1105236579 13:18561468-18561490 TTTTTAACCAAAATAAATGAGGG - Intergenic
1105543558 13:21335851-21335873 CTTTTAAACAAAGTAAAACCTGG + Intergenic
1105562750 13:21510253-21510275 GTGTTATGCAAAATAACAGAAGG - Intronic
1105735132 13:23260368-23260390 ATGGAAAGCAAAATAAAAGCAGG - Intronic
1106410735 13:29509593-29509615 CCTTAAAGTAAAATAAAAGCAGG + Exonic
1106861042 13:33909177-33909199 GATTTAAGAGAATTAAAAGCAGG + Intronic
1107581542 13:41794081-41794103 ATCTTAAGAAAAAAAAAAGCTGG - Intronic
1107789077 13:43982655-43982677 GCTTTAAGCAACATTACAGCAGG - Intergenic
1108557503 13:51609296-51609318 GTTCTATTCAAAATAACAGCAGG - Intronic
1108921478 13:55679885-55679907 ATTTGTAGCAAAATAGAAGCTGG + Intergenic
1109540612 13:63774425-63774447 GTTTTAAGCAAAAGAGAAACGGG + Intergenic
1111119397 13:83825185-83825207 GGTTTCAGCAAAAGCAAAGCTGG - Intergenic
1111395091 13:87656287-87656309 GTGTTATACAAAATAAAAGTTGG - Intergenic
1111508894 13:89233848-89233870 CTTTTAAGCATAATAACACCTGG + Intergenic
1112638825 13:101248343-101248365 GTGTCAACCAAACTAAAAGCTGG + Intronic
1113314359 13:109162763-109162785 GGTGAAAGCAACATAAAAGCAGG + Intronic
1113408947 13:110066716-110066738 GTTTCAAGGAAAAGAAAGGCAGG - Intergenic
1113985285 13:114310020-114310042 GGTTGAAGAAAAAAAAAAGCAGG - Intergenic
1114469323 14:22948435-22948457 GTTTTTAAAAAAAAAAAAGCGGG + Intronic
1114749063 14:25183140-25183162 GTTTTCAGGAAAATAAATGAAGG + Intergenic
1114962609 14:27912894-27912916 GTTTTAACCAAAAAAAAATTGGG + Intergenic
1115197314 14:30815349-30815371 GTTTAGAGCAAAATAATAACAGG + Intergenic
1115305021 14:31924730-31924752 GTTAGAAGGAAAATAAAAACAGG + Intergenic
1116501253 14:45625261-45625283 TTTTTAAGCAGAATACTAGCAGG - Intergenic
1118220502 14:63851784-63851806 GTTTTAAGAAAAGTTAAGGCCGG + Intergenic
1118377107 14:65187099-65187121 GACTTAAGCAGCATAAAAGCAGG - Intergenic
1119127605 14:72142236-72142258 ATTGTTACCAAAATAAAAGCTGG - Intronic
1119374796 14:74181286-74181308 TTTTTAAGAAGAAAAAAAGCCGG + Intronic
1120217177 14:81692751-81692773 GTTTTAAAAATAATAAAAGTTGG - Intergenic
1120380529 14:83773280-83773302 ATTTTCAACAAAATAAATGCAGG + Intergenic
1120948198 14:90017456-90017478 GTTACAAGCCAAATAAAAGGAGG + Intronic
1122334989 14:100967855-100967877 GTATTAAACACAATAAAAGAAGG + Intergenic
1122533940 14:102448963-102448985 TTTAAAAGCAAAATTAAAGCTGG + Intronic
1202869698 14_GL000225v1_random:150388-150410 GTCTTAAGAAAAAAAAAAGGAGG + Intergenic
1123639846 15:22393348-22393370 ATTTTAAGCAAAAAAAAAAAAGG + Intergenic
1123689898 15:22829652-22829674 CTATAAAGCAAAATATAAGCAGG - Exonic
1123906672 15:24928636-24928658 GTTTCAAAAAAAATAAAAGAGGG - Intronic
1125024415 15:35016250-35016272 GCTTTAAGCAACATGAAAGAAGG + Intergenic
1125060885 15:35422070-35422092 GCTTTGAGCAAATTAAAAGATGG + Intronic
1125199370 15:37087448-37087470 GTTGTAATTAATATAAAAGCAGG + Intronic
1126832930 15:52627470-52627492 TATATAAGCAAAATGAAAGCAGG + Intronic
1126916307 15:53469839-53469861 GTATTAACCATAATAAAAGAGGG - Intergenic
1126958492 15:53962162-53962184 AGTTTAAACAAAATACAAGCAGG - Intergenic
1127472951 15:59307133-59307155 ATTTTCAGTTAAATAAAAGCTGG - Intronic
1127729208 15:61783144-61783166 GTATTAAGCAAAATAATACATGG + Intergenic
1128019709 15:64380084-64380106 TTATTAAGAAAAATAATAGCTGG + Intronic
1128428981 15:67572994-67573016 GCTTTAAACAAAATAATATCAGG - Intronic
1130441480 15:83958903-83958925 GTAATAAGCAAAATAAAAGGAGG + Intronic
1131311083 15:91290430-91290452 GTTTTACACAAAATAACAGGAGG + Intronic
1132312722 15:100868926-100868948 TATTTTGGCAAAATAAAAGCCGG - Intergenic
1133080428 16:3314618-3314640 GATTTAAGAAAAAAAAAGGCGGG - Intronic
1134780507 16:16891009-16891031 GTCATAAGCAAAACAACAGCAGG + Intergenic
1135080548 16:19431046-19431068 GTTTTAAGTCAAATAAATGATGG + Intronic
1135130558 16:19850712-19850734 GCCCTAAGCAAAATAATAGCTGG + Intronic
1135149175 16:19990426-19990448 TCTTTAAGCAAGAAAAAAGCTGG + Intergenic
1135273392 16:21087972-21087994 GTTCTTAGCAAAATAAAGGAAGG - Intronic
1135702154 16:24641966-24641988 GTATTAATCAAAGTAAAAGCTGG + Intergenic
1136501651 16:30673292-30673314 CTTTTGAGCAAAACAACAGCCGG + Intergenic
1138071588 16:53997856-53997878 ATTTTAAGCATAATAAAAGCAGG + Intronic
1138321124 16:56112881-56112903 ATTTTAAGCAAAATAAGGGGAGG + Intergenic
1138618161 16:58188932-58188954 GTTAAAAGAAAAATAAAAACTGG + Intronic
1139104317 16:63808290-63808312 GTTATTAGAAAAATAACAGCAGG + Intergenic
1139186586 16:64812764-64812786 TTTATAAGCAAAATACAAGCAGG - Intergenic
1139233028 16:65305056-65305078 GTTTTAAACAAAAGAAAGGATGG - Intergenic
1140527452 16:75635099-75635121 ATCTTAAGTGAAATAAAAGCAGG + Intronic
1140619251 16:76707956-76707978 ATTTTTTGCAAAATAAAAGAGGG - Intergenic
1141305166 16:82856072-82856094 GGTTTAAGAAAAATACTAGCTGG + Intronic
1143064559 17:4235388-4235410 GTTTTAAGCAATTTGACAGCAGG + Intronic
1144261370 17:13525312-13525334 GTTTTAAGGAAAAAAAAATTAGG - Intronic
1146553164 17:33799558-33799580 TTTTGGAGAAAAATAAAAGCAGG - Intronic
1146604618 17:34247604-34247626 GTTTCAAGCAAAGTGGAAGCTGG + Intergenic
1147029614 17:37621836-37621858 ATTTTAAGCAGAATAAAAAAAGG - Intronic
1148025514 17:44584907-44584929 TTTTTAAGAAAAATATAGGCCGG + Intergenic
1149116402 17:53102118-53102140 GCTTAAGGCAAAATAAAAGGAGG - Intergenic
1149709250 17:58724705-58724727 ATTTTCAAGAAAATAAAAGCTGG - Intronic
1150968712 17:70002197-70002219 GTTTTAAGCATTATAATAGATGG - Intergenic
1151737000 17:75949158-75949180 GTTTTAAGAAAAATAATTGTTGG - Intronic
1153553056 18:6282673-6282695 GTTTTAAGCAAAGGAAAGGTAGG + Intronic
1153604945 18:6823749-6823771 GTTTCAAAAAAAATAAAAGAAGG - Intronic
1154369143 18:13742689-13742711 GTCTTAAGGGAAAGAAAAGCGGG + Intronic
1154512955 18:15128448-15128470 TTTTTAACCAAAATAAATGAGGG + Intergenic
1156100077 18:33582855-33582877 GTTTTAAGTAAATTAAAATTTGG + Intronic
1156234868 18:35192781-35192803 GTTTTCAGCAAAATCAAAGTGGG - Intergenic
1156368066 18:36447820-36447842 CTGTTAAGGTAAATAAAAGCAGG + Intronic
1156884543 18:42119072-42119094 GTTTTCAGAAATATAAAAACTGG - Intergenic
1157026515 18:43850980-43851002 GTATTAAGAAAAAAAATAGCAGG - Intergenic
1157240050 18:46000333-46000355 TCTTTAAGCAAAATAAATGATGG - Intronic
1157253820 18:46120235-46120257 GTTTCAAAAAAAAAAAAAGCTGG - Intronic
1157899416 18:51500008-51500030 CTTTTAATCAATAAAAAAGCAGG - Intergenic
1158167761 18:54559609-54559631 ATCTTAAGCAAAATTAATGCAGG - Intergenic
1158253044 18:55510968-55510990 GCAATAAGCACAATAAAAGCAGG + Intronic
1158530689 18:58257038-58257060 CTATTCAGAAAAATAAAAGCAGG - Intronic
1158562040 18:58522565-58522587 GTCTTAAGGAAAACAAAAGATGG - Intronic
1159487820 18:69088289-69088311 TTTTAAAGCAAAATATGAGCAGG - Intergenic
1159994114 18:74945633-74945655 ATTGTAAGTAAAATAAAATCAGG - Intronic
1160220166 18:76970361-76970383 TCTTTAACCAAAATAAAAGTAGG - Exonic
1161178447 19:2862995-2863017 GCTCTCCGCAAAATAAAAGCAGG + Intergenic
1163417955 19:17198058-17198080 GTTTCAAAAAAAAAAAAAGCAGG + Intronic
1163475233 19:17522023-17522045 GTCTCAAGAAAAAAAAAAGCTGG + Intergenic
1163962513 19:20710310-20710332 GTTTTATGAAAAAGAAAAGGGGG - Intronic
1164027823 19:21369082-21369104 GATTTAATCAAAATAAAATATGG - Intronic
1165667292 19:37643501-37643523 GTTTAAATTAAAATAAAACCAGG - Intronic
1166605271 19:44136702-44136724 GTTGTATGGAAAATAAAAACTGG - Intergenic
1166909739 19:46144661-46144683 TTTTTAAATAAAATAAAATCAGG - Intronic
1168389634 19:55995534-55995556 ATTTTGAGCAAAAAGAAAGCTGG - Intergenic
1202631407 1_KI270706v1_random:3566-3588 GTTTTAAGCAAAATTATGGGAGG - Intergenic
925293469 2:2763290-2763312 GTTTAATGCAAAATGAATGCCGG + Intergenic
925753325 2:7109541-7109563 GCTTTAAGAAAAATAAACACAGG + Intergenic
925842877 2:8008961-8008983 GTGTAAAACAAAATAAAAACAGG - Intergenic
926255509 2:11191816-11191838 ACTTTAAGCAAAATAATGGCTGG - Intronic
926898238 2:17719206-17719228 TTTTTAATAAAAATGAAAGCTGG + Intronic
927405252 2:22758911-22758933 GGGTTTAGCAAAATAAAACCAGG - Intergenic
928858760 2:35830702-35830724 GTTTTAAGAAAAATAAAAAAGGG + Intergenic
929035420 2:37686719-37686741 GTTTTAAGCAAAATAACTAAGGG - Intronic
929299288 2:40283913-40283935 CTTTTCAGAAAAATAAAAGGTGG - Intronic
929813880 2:45215211-45215233 GTTTTAACCCCAATAAAAGAGGG - Intergenic
930179929 2:48344813-48344835 GTCTTAAGCAAAACAAACTCTGG + Intronic
930489863 2:52055619-52055641 GTGTTAAGCACCAGAAAAGCTGG - Intergenic
930528301 2:52559346-52559368 CTTTTAAGTAGAATAAAACCTGG - Intergenic
930579428 2:53192432-53192454 CTTATCAGCAATATAAAAGCTGG - Intergenic
931187059 2:59963289-59963311 GCTTTCAGCCAAATAAAAGTGGG - Intergenic
931398407 2:61908519-61908541 CTTTTAAGTTAAATAAAGGCTGG - Intronic
931773403 2:65518680-65518702 GTTTTAAGCAGAAAGAAAGGAGG - Intergenic
934928706 2:98402095-98402117 GTTTTAAGAGAAATCAAAGATGG + Intergenic
934944367 2:98527308-98527330 GAGTTAAGCCAAATAAAGGCAGG - Intronic
935958025 2:108398083-108398105 GTTTTAAGCAAAACAAATGATGG + Intergenic
936639497 2:114296296-114296318 GTTTTAATTAAGATAAAAGAGGG + Intergenic
936922509 2:117703353-117703375 TTTTTAAAGCAAATAAAAGCAGG + Intergenic
937193681 2:120130546-120130568 ATTTGAAGCATAATAAAACCAGG + Intronic
937728825 2:125201596-125201618 ATTTTAAGTAAAACAAAAACTGG - Intergenic
938231190 2:129660638-129660660 ATATTAAGCAAAATAAAATTCGG + Intergenic
938513209 2:131973087-131973109 TTTTTAACCAAAATAAATGAGGG + Intergenic
939119975 2:138104483-138104505 TTTTGAAGCCAAACAAAAGCAGG - Intergenic
939372230 2:141316107-141316129 GGTTCAAGCAGAATAAAACCTGG - Intronic
939762517 2:146200193-146200215 ATTAAAAGCAAAATAATAGCTGG + Intergenic
940062279 2:149585914-149585936 ATTTAAACCAAAATAAAACCAGG + Intronic
940576875 2:155519430-155519452 TTTTTATTCAAAATAACAGCTGG + Intergenic
940903541 2:159148042-159148064 GTTTTAGGAAAAATAAAATGAGG - Intronic
941805621 2:169709373-169709395 TGTTTAAGCATAATAAAAACTGG - Intronic
942447680 2:176088811-176088833 TTTTTTTGGAAAATAAAAGCTGG - Intergenic
942451938 2:176113527-176113549 CTCATAAGCAAAATAAAGGCTGG + Intronic
942681202 2:178480050-178480072 ATTTTATGTAAAATAAAAACAGG + Intergenic
942719057 2:178928647-178928669 TCTGTAAGCAAAATAACAGCAGG + Intronic
943510796 2:188824863-188824885 ATTTTAATCAGAATATAAGCAGG + Intergenic
943515548 2:188881568-188881590 GTTGTAAGCTAGGTAAAAGCTGG + Intergenic
943522066 2:188964134-188964156 ATTTTAAGAAAAATAAAAATAGG + Intergenic
943663563 2:190585295-190585317 GTTTAAAGATAAATAAAAGATGG - Intergenic
943689419 2:190854237-190854259 GATATAAGCATAATAAAAGAAGG - Intergenic
944584655 2:201162774-201162796 CTGTTAAACAAACTAAAAGCAGG - Intronic
944815040 2:203367319-203367341 GTTTTAAAAAAAAAAAAAGGCGG - Intronic
945001878 2:205360558-205360580 GTATTAAGAAAAAATAAAGCTGG - Intronic
945232704 2:207608978-207609000 GTTTAAAACAAAATAAAGCCTGG - Intronic
946507803 2:220319969-220319991 ATTTTAAGAAATATAATAGCTGG + Intergenic
946867156 2:224052191-224052213 GTTGAAATCCAAATAAAAGCTGG - Intergenic
947619290 2:231578322-231578344 CATTTAAAAAAAATAAAAGCGGG - Intergenic
948029357 2:234804182-234804204 GTGTTATTCAATATAAAAGCTGG + Intergenic
948230526 2:236345817-236345839 GTTTTAAGAAATATAAAAATAGG - Intronic
949029889 2:241788924-241788946 CTTTTAAGAAAAAAAAAAGTGGG + Intronic
1169623606 20:7537872-7537894 TTTTTAAGCAAACTACAATCTGG - Intergenic
1169768159 20:9171645-9171667 GTTTTAAGAAAAATAAATTCAGG + Intronic
1169895063 20:10495796-10495818 ATTTTAACCAAAAGAAAAACAGG - Intronic
1170141091 20:13125514-13125536 GTTTTAAGCTAAATAAATGGTGG - Intronic
1170173016 20:13436345-13436367 GTTTTAAAAAAAAAAAAAGGAGG + Intronic
1170678289 20:18502325-18502347 GTTTTAAGCAAGAGAATAGTAGG + Intergenic
1170873215 20:20227210-20227232 GTTTTAAGAAAATCCAAAGCAGG + Intronic
1170997692 20:21379904-21379926 GTTTTAAGAAAAATAAAGATGGG - Intronic
1171939494 20:31311994-31312016 GTTCTAACAAACATAAAAGCAGG + Intergenic
1172986660 20:38996994-38997016 GTTTTCAACATAATAAAAACTGG - Intronic
1173351582 20:42250492-42250514 CTCTTAAGCAAAAAAAAAGGGGG - Intronic
1174142445 20:48425385-48425407 GCTTTAAGAAAAATTAAAGAGGG - Intergenic
1174605393 20:51757601-51757623 GTTTAGACAAAAATAAAAGCAGG + Intronic
1174715133 20:52749614-52749636 ATATTAAGCAAAATCAAAGTTGG - Intergenic
1175338446 20:58211826-58211848 GTTTCAAAAAAAAAAAAAGCAGG + Intergenic
1176326665 21:5507651-5507673 GTTTTAAGTAAAAAAATAGGAGG - Intergenic
1176401092 21:6313300-6313322 GTTTTAAGTAAAAAAATAGGAGG + Intergenic
1176436065 21:6675804-6675826 GTTTTAAGTAAAAAAATAGGAGG - Intergenic
1176460327 21:7002874-7002896 GTTTTAAGTAAAAAAATAGGAGG - Intergenic
1176483888 21:7384652-7384674 GTTTTAAGTAAAAAAATAGGAGG - Intergenic
1176780567 21:13189754-13189776 TTTTTAACCAAAATAAATGAGGG - Intergenic
1177213722 21:18102504-18102526 AAATTAAGCAGAATAAAAGCAGG - Intronic
1177481210 21:21691652-21691674 GTTTAAAAAAAAATTAAAGCAGG + Intergenic
1177978248 21:27878865-27878887 TTTTTAACCAAAATAAATGAGGG - Intergenic
1178562023 21:33647379-33647401 ATGTTAAGCAAAAAAAAAGCAGG - Intronic
1178996703 21:37408299-37408321 GTTTTTCGAAAAATTAAAGCAGG - Intronic
1179053951 21:37914753-37914775 TTTTTCAGCAAAAGAAAGGCAGG + Intronic
1179078962 21:38152393-38152415 TTATGAAGAAAAATAAAAGCAGG + Intronic
1181813138 22:25417222-25417244 GTTGTTAGCAAAATAAACTCTGG + Intergenic
1182403377 22:30101584-30101606 GTATTAAAAAAAAAAAAAGCTGG + Intronic
1182819755 22:33205509-33205531 GTTTTAAGGACAATAAAACTGGG + Intronic
1182990034 22:34758873-34758895 GTTTTCAGCCAAGAAAAAGCTGG - Intergenic
1184350337 22:43939361-43939383 TTTTCAAGGAAAATAAAAGCAGG + Intronic
1184630518 22:45774626-45774648 GTTTTTTACAAAATAAAGGCAGG + Intronic
949090314 3:19449-19471 GTGTAAAGGAAAAAAAAAGCTGG + Intergenic
949222475 3:1652403-1652425 ATGTAAAACAAAATAAAAGCAGG - Intergenic
949746302 3:7296817-7296839 TTTTTAAAAAAAAAAAAAGCTGG + Intronic
949814039 3:8039679-8039701 GTTTTCAGTGAAATAAAAACAGG + Intergenic
949916031 3:8965341-8965363 GTTCCATGTAAAATAAAAGCAGG + Intergenic
951764318 3:26180060-26180082 GTTTTAAGAAAAATGTAGGCCGG - Intergenic
952384713 3:32831832-32831854 CTTTTAAGGAAGATAACAGCCGG - Intronic
953265667 3:41384879-41384901 CTTTTTAAAAAAATAAAAGCTGG - Intronic
955232810 3:57113887-57113909 GTTTAAATAAAAATTAAAGCTGG + Intronic
956377705 3:68633683-68633705 GTTTTGAAAAAAAAAAAAGCTGG + Intergenic
956469680 3:69553578-69553600 GCTTGAAAAAAAATAAAAGCAGG - Intergenic
957248641 3:77744905-77744927 CTTTTAAGCAAAAATAAAGTAGG - Intergenic
957325481 3:78687533-78687555 GATTTAAGCAAAATTAAAAAAGG + Intronic
957553284 3:81733986-81734008 GTATTTAGCAAAATAATAGATGG - Intronic
957712767 3:83884885-83884907 GTTATAAGAAAAAAAAATGCAGG - Intergenic
957817154 3:85315492-85315514 GGTTTAAGCATAAAAAAAACTGG + Intronic
958452010 3:94284781-94284803 GATTTAATCAAAATCACAGCTGG - Intergenic
958454736 3:94316268-94316290 GTTTTAAGAAAGTAAAAAGCTGG + Intergenic
958532863 3:95356884-95356906 GTTTTAAGAAAAAAAAAACAAGG + Intergenic
958558830 3:95716488-95716510 GTTTAAAACAAAAGAATAGCTGG + Intergenic
959281652 3:104348791-104348813 CTTTTAAGAAAAAAAAAAGTGGG + Intergenic
959429655 3:106236776-106236798 GTTCTGAGCCAAAGAAAAGCGGG - Intergenic
959766035 3:110029626-110029648 GTTATAAAGAAAAGAAAAGCAGG - Intergenic
960979906 3:123213851-123213873 GTTTGAAGGAAAAAAAAATCAGG + Intronic
960994899 3:123334099-123334121 CTTTTAAGAAAAATAAATTCAGG - Intronic
964514457 3:157492969-157492991 GTTTTAAGAAAGATATCAGCAGG - Intronic
965129165 3:164672694-164672716 GTTTTAAGAAAAAAAAATACAGG - Intergenic
965827995 3:172750400-172750422 GTTTAAAAAAAAAAAAAAGCTGG + Intergenic
965983313 3:174720155-174720177 GTTTGACGTAAAATAAAAACTGG - Intronic
966612490 3:181881454-181881476 ATTTTAAGCAAAGAAAAAACTGG - Intergenic
972221526 4:36961363-36961385 GTTATAAGGAAAATCAGAGCAGG - Intergenic
972511824 4:39773995-39774017 GTCTTAAGAAATAGAAAAGCTGG + Intronic
973654122 4:53027945-53027967 GTTTTAAGAAAAATATATGTGGG + Intronic
974446340 4:61987473-61987495 ATATTAAATAAAATAAAAGCAGG - Intronic
974749762 4:66122489-66122511 GTTTAAAAAAAAATACAAGCTGG - Intergenic
975173872 4:71264855-71264877 GTTTTGAGCAAAAGATACGCTGG + Intronic
975198771 4:71559740-71559762 GTTTAAAGTAAAAAAATAGCTGG - Intronic
975362213 4:73484537-73484559 GTTTCAAGAAAAAAAAAAGAAGG - Intronic
976692608 4:87884816-87884838 GTTTAAAGGAAAAATAAAGCAGG + Intergenic
976780834 4:88757138-88757160 GTTTTAAGGAAACTATAAGCTGG + Intronic
977164021 4:93672719-93672741 GGTATAAGCAAAAACAAAGCAGG - Intronic
977324015 4:95552094-95552116 GTTATATGCAAAATCAAAGCTGG - Intergenic
977367519 4:96089709-96089731 GGTATAAGCAAAAGAACAGCAGG - Intergenic
978212143 4:106149799-106149821 GTTTTATACAAATTAAAAGTTGG - Intronic
978695489 4:111572046-111572068 GTATTTAGAAAAATAAAAGGTGG - Intergenic
979014020 4:115409018-115409040 ATTTTAAATAAAATAAAAGGAGG - Intergenic
979062669 4:116083294-116083316 GCTTTAAGAAAAAGAAAAGTGGG - Intergenic
979366533 4:119831266-119831288 TTTTTAAAGAAAATAAAAGCAGG + Intergenic
979563859 4:122131991-122132013 GGTTGAAGCAAAGCAAAAGCAGG + Intergenic
979685578 4:123507458-123507480 CTTTTAAGAAAAATAAAAAATGG - Intergenic
979870303 4:125811191-125811213 TTGCTGAGCAAAATAAAAGCTGG + Intergenic
980929925 4:139176186-139176208 TTCTTAAGCAAAACAAAAACGGG - Intronic
981634995 4:146866939-146866961 GTTTTTAGCCAAACAAAACCTGG + Intronic
982034244 4:151330064-151330086 ATTTCAAAAAAAATAAAAGCAGG + Intergenic
982733204 4:158978740-158978762 GTGGAAAGCAAAAAAAAAGCAGG - Intronic
983269558 4:165545330-165545352 GGCTTAAGCAAAATATAACCTGG + Intergenic
983315315 4:166125106-166125128 GTAACAACCAAAATAAAAGCTGG - Intergenic
983340697 4:166456604-166456626 GTTTTTAGCAAAATAAGAAAAGG + Intergenic
984186466 4:176549606-176549628 GTTTTAAGCTCCTTAAAAGCAGG + Intergenic
984477749 4:180258755-180258777 TTTTAAAGGATAATAAAAGCTGG + Intergenic
984658637 4:182348473-182348495 ATTTTAAGAAAATTAAATGCTGG - Intronic
984836753 4:184029451-184029473 GTTTTAAAAAAAAAAAAAGCCGG + Intergenic
985126825 4:186702749-186702771 AATTTAAGCAGAATAAAATCTGG - Intronic
986745436 5:10739923-10739945 TTTTTAAGTAAAGTAAAACCTGG - Intronic
987832401 5:23112182-23112204 GCTTCAAGAAAAATAAAAGAGGG + Intergenic
988062387 5:26188392-26188414 TTTAAAAGCAAAATAAATGCCGG - Intergenic
988084831 5:26461610-26461632 CTTTTTAGAAAAAAAAAAGCTGG - Intergenic
988769404 5:34416168-34416190 CTTTTAAGAAAAAGAAAAGCGGG + Intergenic
988806963 5:34749453-34749475 GATTAAACCAAAATAAAAGAAGG + Intronic
988828924 5:34968870-34968892 GTATTAAGGTAAAAAAAAGCAGG + Intergenic
990211993 5:53490893-53490915 GATTCCAGCAAAATAGAAGCTGG - Intergenic
990457940 5:56005885-56005907 GTGTTAAGCAAAATAACTTCAGG - Intergenic
991361154 5:65821836-65821858 CTTTTAAGGAAAATAAAACATGG - Intronic
993062703 5:83058771-83058793 CTTTTAAGAAAATTAAAAACAGG - Intronic
993949103 5:94151597-94151619 GTTTAAAGGAAGATAAAAGTAGG - Intergenic
994278853 5:97875730-97875752 GTTTGAGGCAAAATAAAAGGTGG + Intergenic
994293482 5:98059866-98059888 ATTTTGAGCATAATAAAACCAGG + Intergenic
994437221 5:99752826-99752848 GTTTCAAGCAAAATAAACGTTGG + Intergenic
995415657 5:111910158-111910180 GTTTTAACCAGAATATAATCAGG - Intronic
995665906 5:114542001-114542023 CTTTTTAGAAAAATAAAAGCAGG + Intergenic
995807448 5:116069345-116069367 AATTTAAGCAAAAAAAAAGGGGG + Intergenic
996074425 5:119173397-119173419 ATTATAAGCAAAATAAATGATGG - Intronic
996212522 5:120828996-120829018 ATTTTCAGAAAAAGAAAAGCTGG + Intergenic
998787394 5:145727500-145727522 GTTTTATGAAAAAGAAAAGGGGG - Intronic
1000333160 5:160221808-160221830 GTTTTAACCAAAATGAAATTCGG - Intronic
1000443584 5:161292892-161292914 TTTGGAAGCAAAAAAAAAGCTGG + Exonic
1000472982 5:161669429-161669451 GTTTGGAGAAAAATAAAAGGAGG - Intronic
1001228866 5:169968756-169968778 GTGATGAGCAAAATAAAAGGAGG + Intronic
1001344693 5:170882699-170882721 GGTATATGTAAAATAAAAGCAGG + Intronic
1001469445 5:171999961-171999983 GTTTTAATGAAACTAAAAGATGG - Intronic
1001843780 5:174903237-174903259 GTGTCATGGAAAATAAAAGCAGG + Intergenic
1003184806 6:3821478-3821500 ATTTAAAAAAAAATAAAAGCAGG + Intergenic
1003204890 6:3999284-3999306 TATTTAAAAAAAATAAAAGCTGG + Intergenic
1003408469 6:5842193-5842215 CTTTTAAACAAAGTAAAACCTGG - Intergenic
1003520209 6:6851865-6851887 CTTTGAAGCACAAGAAAAGCAGG + Intergenic
1003523594 6:6879997-6880019 GTTTTAAGAAAAAGAAAATGTGG + Intergenic
1003651063 6:7960881-7960903 GTTAAAAGCAAAATAAAACAGGG + Intronic
1003706653 6:8539050-8539072 GTTTGGAGAAAAATAAAATCAGG - Intergenic
1004451630 6:15753192-15753214 GTTTTAAGCTAAATTATATCTGG - Intergenic
1004659090 6:17693991-17694013 GTTTTAATAAAAAATAAAGCTGG - Intronic
1006605386 6:35252603-35252625 TTCTTAAGCACAATAAAAGTGGG + Exonic
1006854621 6:37124244-37124266 GTCTCAAGAAAAATAAAAGAAGG - Intergenic
1008290313 6:49706830-49706852 GTTCTTAGGAACATAAAAGCAGG - Intronic
1008383854 6:50864698-50864720 GCTTTGAGCAAAAACAAAGCTGG - Intergenic
1009717065 6:67411548-67411570 ATTTTATGCAAAAAAAAATCAGG + Intergenic
1010630725 6:78194287-78194309 GTGTTAAGTAAAAAAAAAACAGG - Intergenic
1010869794 6:81022774-81022796 GTTTTAAGGCAAATGAGAGCTGG - Intergenic
1011937018 6:92792371-92792393 GTATTAAACATAATACAAGCTGG - Intergenic
1012129144 6:95469305-95469327 GGGTTAAGGAAATTAAAAGCTGG - Intergenic
1012158985 6:95858832-95858854 ATTTTAAGCTCAATAAAAGCAGG - Intergenic
1012578978 6:100840674-100840696 ATGTTAAGGAACATAAAAGCAGG + Intronic
1013285176 6:108675190-108675212 AATTTAAGCAACAGAAAAGCTGG + Intronic
1013893948 6:115062438-115062460 GAATTAACAAAAATAAAAGCCGG - Intergenic
1014041296 6:116829492-116829514 TTTTCAGGAAAAATAAAAGCAGG - Intergenic
1014159061 6:118146199-118146221 TTTTTAGCCATAATAAAAGCAGG + Intronic
1014469817 6:121800406-121800428 CTTCTGAGCAAAAGAAAAGCAGG - Intergenic
1015491168 6:133827197-133827219 ATTTTAAGGAAAAAAAAATCAGG - Intergenic
1016195139 6:141326980-141327002 GTTAAAAGAAAAACAAAAGCTGG + Intergenic
1016293434 6:142548784-142548806 GTATTAGAAAAAATAAAAGCAGG - Intergenic
1016644289 6:146387393-146387415 ATTTTATACAAAATAAAAGCTGG - Intronic
1016644295 6:146387478-146387500 GTTTTAAGCAAAATAAAAGCCGG - Intronic
1016789123 6:148049564-148049586 GTTTTAAGCTAAATAAATATGGG - Intergenic
1017043386 6:150325406-150325428 GTTACAAGCAAAATGGAAGCTGG + Intergenic
1018405599 6:163478970-163478992 GTTTTAAGCACAAAAAAATCTGG - Intronic
1019041934 6:169113120-169113142 CTTTTAAGAAAAAAAAAAGGTGG + Intergenic
1019831893 7:3338670-3338692 GTTTAAAGAAAAAAAAAAGTGGG + Intronic
1020583725 7:10037888-10037910 GTAATAAGCAAAATTAAAGATGG - Intergenic
1020838781 7:13188140-13188162 AGTTTAAGCAAAATAACAGATGG - Intergenic
1021158073 7:17236693-17236715 CATTTAAGCAAAAGAAGAGCAGG - Intergenic
1022135796 7:27447368-27447390 ATTGAAAGCAAAAAAAAAGCAGG - Intergenic
1022876828 7:34542272-34542294 GTTTTCATCACAATAAAAGAGGG - Intergenic
1022941792 7:35248973-35248995 GCTTTAAACAAAACAAAAGAGGG - Intronic
1024496608 7:50055372-50055394 GTTTTAAGCATAAAAAGAGTAGG + Intronic
1024752936 7:52490052-52490074 CTTATAAGCAAAACAAATGCAGG - Intergenic
1025072784 7:55915501-55915523 GTTTTAAACAAAATGAAAACAGG + Intronic
1026451968 7:70537238-70537260 GTGTAAAACAAAATAAAAGCAGG + Intronic
1028064214 7:86361560-86361582 TTTTTAAGAAAAACAAAACCAGG + Intergenic
1029062501 7:97812648-97812670 GTGGAAAGCAAAAAAAAAGCAGG + Intergenic
1029971443 7:104793337-104793359 GTTTAAATCAACATGAAAGCAGG + Intronic
1030282885 7:107795410-107795432 CTTTTAAGCATAATAGAAACAGG - Intronic
1030377416 7:108769878-108769900 TTTTTAAGGAAAATAACATCAGG - Intergenic
1031097869 7:117442462-117442484 GTTTTAAACCAAATACATGCAGG - Intergenic
1031642634 7:124183790-124183812 GTTTAAAATAAAATAAAAGCAGG - Intergenic
1031643022 7:124189120-124189142 GCTTTAACCAAAATAAAAGCAGG + Intergenic
1031700733 7:124922357-124922379 CTTTTAAGGAAATTAAAAGAAGG - Intronic
1032155960 7:129468322-129468344 GTTTTAAGCTACATATAAGTAGG - Intronic
1032370413 7:131344750-131344772 CTTTTAAACAAAATAAAAGGAGG + Intronic
1033050868 7:138002873-138002895 CTATAAAGAAAAATAAAAGCAGG + Intronic
1033849942 7:145482771-145482793 TTTTTAAGCAAAATTATAGGAGG - Intergenic
1034372606 7:150613052-150613074 GTTTTATGAAAAAGAAAAGGGGG - Intergenic
1036059282 8:5296940-5296962 ATTTTTTGCAAAAGAAAAGCTGG + Intergenic
1036545545 8:9766314-9766336 GTTTTCAGCAAAATAAATCCCGG - Exonic
1037167545 8:15848807-15848829 GTTTTAAGGAATGTAAAAGTTGG - Intergenic
1038204220 8:25449446-25449468 GTATTAAGCATAATACAGGCAGG - Intronic
1039975670 8:42362820-42362842 CTTTAAAGAAAAATAATAGCAGG + Intronic
1040046843 8:42972983-42973005 GTATAAAACAAAATAAATGCTGG - Intronic
1041459865 8:58099209-58099231 GTTTTAAGAAAAATGAATGCAGG + Intronic
1041495367 8:58480330-58480352 CATTTATACAAAATAAAAGCAGG - Intergenic
1042059338 8:64799737-64799759 GTTTTGAACAGAGTAAAAGCTGG - Intergenic
1042572824 8:70185183-70185205 GTAGTAAGCAAAATGAAACCGGG - Intronic
1043453423 8:80391473-80391495 GTTTTAAGCAAAGGAAAAAAAGG - Intergenic
1044081632 8:87892474-87892496 CTTTTAAGCTACATAAAAGCAGG + Intergenic
1044237706 8:89850867-89850889 TATTTAAGGTAAATAAAAGCTGG + Intergenic
1044627942 8:94252761-94252783 GTTTTAGGGAAAATACAAACAGG - Intronic
1044680218 8:94770185-94770207 ATTTTCAGCAAAATAAAAAAGGG - Intronic
1044835438 8:96291112-96291134 GTCTTATGCAGAAGAAAAGCTGG - Intronic
1045010564 8:97955229-97955251 GTTTTAAGCAGAAGAGAGGCAGG + Intronic
1045701151 8:104867866-104867888 TTTGTAAGAAAAATAAAAGTGGG - Intronic
1045866557 8:106872702-106872724 GCTATAAGCAAAGTGAAAGCAGG + Intergenic
1046577704 8:116051646-116051668 GTTTTAATCATAATCAAAACTGG - Intergenic
1047129562 8:122003570-122003592 GTGGAAAGCAAAAAAAAAGCAGG + Intergenic
1050093421 9:2039229-2039251 GTGTTAAAAAAAAAAAAAGCAGG - Intronic
1050418730 9:5440313-5440335 TTGTTAAGGAAAATCAAAGCTGG + Intergenic
1051761823 9:20475629-20475651 GTTTAAAACAAAACAAAACCTGG + Intronic
1052344556 9:27396178-27396200 GTTTGAAGCAAAAGAAAATGTGG - Intronic
1052760642 9:32587566-32587588 GGTGTAGGCAAAATAAAGGCAGG - Intergenic
1056259959 9:84838768-84838790 ATTTAAAGCAAAATAAATGGTGG + Intronic
1056822273 9:89851687-89851709 GTTTTATGGAAATTAAAATCCGG + Intergenic
1057599805 9:96448538-96448560 CTATTAAGGAAAGTAAAAGCTGG + Intergenic
1057797299 9:98167979-98168001 GATTTAAGCAAGAAAGAAGCAGG + Intronic
1058869164 9:109187706-109187728 TTTTTGAAGAAAATAAAAGCTGG + Intronic
1059252515 9:112898665-112898687 GTAATAAGCAAAATAAAGTCAGG + Intergenic
1059661872 9:116409460-116409482 GATTTTAGAAAAATAAAAGAAGG + Intergenic
1059677832 9:116556538-116556560 GTATGAAACAAAATAAAAACAGG - Intronic
1059751836 9:117254874-117254896 TTTTTAAGAAAAATAGAAGAGGG - Intronic
1059847839 9:118301336-118301358 CTATTTATCAAAATAAAAGCAGG - Intergenic
1060946224 9:127570643-127570665 GTTTTAAGGAAAATCACAGAGGG + Intronic
1061526209 9:131165457-131165479 CTATTAAACAAAATAAATGCTGG + Intronic
1187070869 X:15886818-15886840 CCTTTCAGGAAAATAAAAGCTGG - Intergenic
1187557249 X:20364215-20364237 GTTTTAAGGATAATAGTAGCAGG - Intergenic
1187650295 X:21395105-21395127 GTAATAAGAAAATTAAAAGCTGG - Intronic
1187697935 X:21940195-21940217 GTTTCACGCAAAATAAAATGAGG - Intergenic
1187949179 X:24455204-24455226 GTTTTGAGAAAAAGAAAAACAGG - Intergenic
1188360841 X:29251404-29251426 GTTTTAAGAAAAATAATATATGG + Intronic
1188594002 X:31874465-31874487 GTATTAAGCACAATTAAAACAGG + Intronic
1189070101 X:37854676-37854698 ATCTTAAGCAAAATAAAAAGAGG - Intronic
1189565737 X:42239271-42239293 GCTTTATTCAAAATGAAAGCTGG - Intergenic
1189733692 X:44048254-44048276 GTGTTAAGGGAAATAAAGGCTGG - Intergenic
1191732475 X:64352037-64352059 GTTTTAAGCACAATGCAAGTAGG - Intronic
1193338811 X:80321751-80321773 ATTGAAAGCAAAAAAAAAGCAGG + Intergenic
1193367046 X:80647127-80647149 CTTTTAAGCAAAATAGTAACAGG - Intergenic
1193619704 X:83737090-83737112 GTGTAAAGCAAAGTGAAAGCAGG - Intergenic
1194464369 X:94214175-94214197 CTTTAAAGAAAAACAAAAGCAGG + Intergenic
1194852376 X:98885479-98885501 ATCATAAGCAAAAAAAAAGCTGG + Intergenic
1194945943 X:100067308-100067330 GTTTCAAGCAAAATCCCAGCAGG - Intergenic
1196318089 X:114253642-114253664 GGTTGAATCAAAATAAAAGGTGG + Intergenic
1196360449 X:114849261-114849283 TTTGTAAGCACCATAAAAGCTGG - Intronic
1196631460 X:117944861-117944883 GTAATAACTAAAATAAAAGCAGG - Intronic
1196892105 X:120301020-120301042 GTTTTAAAAAAACTAAAACCAGG - Intronic
1196972725 X:121126853-121126875 ATTTTAAGAAAAAGAAAAGAAGG - Intergenic
1197546781 X:127835388-127835410 TTTTTATGCAAGATGAAAGCAGG - Intergenic
1197872895 X:131076163-131076185 CTTTTAAGAAAATGAAAAGCAGG + Intronic
1198163986 X:134035244-134035266 AATTTAAGCACAATAAAGGCAGG + Intergenic
1198185330 X:134248872-134248894 GATTGCATCAAAATAAAAGCAGG + Intergenic
1198252775 X:134897256-134897278 GTCTTAAGCAAAAAAATAACAGG + Intronic
1198287948 X:135211242-135211264 GTTTTAAGGATTATAAAAGAAGG + Intergenic
1200390527 X:155941013-155941035 ATTTAAAGCAAAATAAAGCCAGG + Intronic
1200809556 Y:7468974-7468996 ATTTTCAGTAAAATAAAATCTGG + Intergenic
1201298171 Y:12483181-12483203 GTTTTAAAAAAAATAATAACTGG - Intergenic