ID: 1016647243

View in Genome Browser
Species Human (GRCh38)
Location 6:146424360-146424382
Sequence TGGTAGTGATTTCTAGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016647232_1016647243 25 Left 1016647232 6:146424312-146424334 CCTGATCTTGTCGGGACTTATGC No data
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1016647236_1016647243 2 Left 1016647236 6:146424335-146424357 CCAACCCCTTGTCAATGGTGGAA No data
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1016647240_1016647243 -4 Left 1016647240 6:146424341-146424363 CCTTGTCAATGGTGGAAAGTGGT 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1016647238_1016647243 -3 Left 1016647238 6:146424340-146424362 CCCTTGTCAATGGTGGAAAGTGG No data
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1016647237_1016647243 -2 Left 1016647237 6:146424339-146424361 CCCCTTGTCAATGGTGGAAAGTG 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1016647235_1016647243 3 Left 1016647235 6:146424334-146424356 CCCAACCCCTTGTCAATGGTGGA 0: 1
1: 0
2: 2
3: 7
4: 103
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1016647231_1016647243 26 Left 1016647231 6:146424311-146424333 CCCTGATCTTGTCGGGACTTATG No data
Right 1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016647243 Original CRISPR TGGTAGTGATTTCTAGACAG GGG Intronic