ID: 1016647574

View in Genome Browser
Species Human (GRCh38)
Location 6:146427504-146427526
Sequence AGCAGACATTTGAACAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016647574_1016647581 10 Left 1016647574 6:146427504-146427526 CCCAATTTGTTCAAATGTCTGCT 0: 1
1: 1
2: 0
3: 24
4: 286
Right 1016647581 6:146427537-146427559 GCCATGGAGGCTGATGAATAGGG 0: 1
1: 0
2: 1
3: 10
4: 178
1016647574_1016647578 -3 Left 1016647574 6:146427504-146427526 CCCAATTTGTTCAAATGTCTGCT 0: 1
1: 1
2: 0
3: 24
4: 286
Right 1016647578 6:146427524-146427546 GCTACTGAACCTGGCCATGGAGG 0: 1
1: 0
2: 2
3: 44
4: 336
1016647574_1016647577 -6 Left 1016647574 6:146427504-146427526 CCCAATTTGTTCAAATGTCTGCT 0: 1
1: 1
2: 0
3: 24
4: 286
Right 1016647577 6:146427521-146427543 TCTGCTACTGAACCTGGCCATGG 0: 1
1: 0
2: 1
3: 23
4: 384
1016647574_1016647580 9 Left 1016647574 6:146427504-146427526 CCCAATTTGTTCAAATGTCTGCT 0: 1
1: 1
2: 0
3: 24
4: 286
Right 1016647580 6:146427536-146427558 GGCCATGGAGGCTGATGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016647574 Original CRISPR AGCAGACATTTGAACAAATT GGG (reversed) Intronic
901937886 1:12639534-12639556 AGCAGATACATGAACACATTAGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
908243607 1:62209447-62209469 AGCAGACAATTGATTAAAATAGG + Intronic
908654481 1:66373399-66373421 AGAATAAAATTGAACAAATTAGG + Exonic
909081436 1:71117319-71117341 TGCTGACATTTTACCAAATTTGG + Intergenic
909105350 1:71399398-71399420 AGCAGATTTTTAAAAAAATTTGG - Exonic
909842989 1:80353018-80353040 TTCAGACATTTGAATAAACTGGG - Intergenic
909877786 1:80830797-80830819 AGTAGACAATTGAATACATTTGG + Intergenic
910171155 1:84378402-84378424 AAAAGACATTTCAAGAAATTAGG - Intronic
912080935 1:105934745-105934767 AGCAGTCATTTAAAGAAAATTGG + Intergenic
912086212 1:106008522-106008544 AGCAGTCCTTTAAACAAATGTGG + Intergenic
914459330 1:147868484-147868506 AGCAGAGATTTGCACATATTAGG + Intergenic
915788088 1:158637956-158637978 AGCATAAATTGGAACAAGTTTGG + Intronic
916241975 1:162649341-162649363 AGCATATATTTAAAGAAATTAGG + Intronic
917302926 1:173596580-173596602 AGAAAAGATTTGAACAGATTTGG - Intronic
917368238 1:174257731-174257753 AGTACACATTTGTACACATTAGG + Intronic
917594809 1:176518257-176518279 AGAATACATTTGAGGAAATTAGG + Intronic
919587849 1:199461603-199461625 ATCAGACATGTGAAGAAAATAGG + Intergenic
921485198 1:215707081-215707103 ATTAGACATTTGGACAAAATGGG + Intronic
922127063 1:222738081-222738103 AGCAAAGATTTAGACAAATTAGG + Intronic
924660897 1:246015854-246015876 AACAGATATTTGTACACATTTGG - Intronic
924750497 1:246883349-246883371 TGTAGGTATTTGAACAAATTAGG + Intronic
924750658 1:246885884-246885906 AGAAAACATTTGAAAAAATAAGG + Intronic
1062973059 10:1662894-1662916 ACCAGACATTTGTACACATGTGG + Intronic
1063457081 10:6191398-6191420 GGCATACATTTGACCAAGTTGGG - Intronic
1063469483 10:6272951-6272973 AGGAGACATGTGAACACTTTAGG - Intergenic
1064837930 10:19555433-19555455 AGCAAACATTTGAAGGAAGTGGG + Intronic
1065032655 10:21603417-21603439 AGGAAACATTTGAATAAAATTGG - Intronic
1065518667 10:26551158-26551180 AGCAGCCAGGTGGACAAATTTGG - Intronic
1067715416 10:48686629-48686651 AACAAACTTTTGAACCAATTAGG - Intronic
1068316594 10:55351728-55351750 AGCAAACATTAGCACAGATTTGG - Intronic
1069149451 10:64938922-64938944 AGTTGACATTTGAACAATGTGGG - Intergenic
1070444911 10:76488244-76488266 AGCATACAATTGAATAAATTTGG + Intronic
1071027033 10:81126869-81126891 AGCAGACATTTGAAGAAACCAGG + Intergenic
1071877890 10:89862274-89862296 AGCAGGGAGCTGAACAAATTAGG - Intergenic
1071915658 10:90292600-90292622 AGAAGAAATTTGAGCATATTTGG + Intergenic
1077385217 11:2266390-2266412 AGCGGACCTTTGATCAAGTTTGG - Intergenic
1079385970 11:19980074-19980096 AGAAGGCATTTGAACAACTTGGG + Intronic
1079856157 11:25608140-25608162 AGAAGACACTTGATAAAATTCGG + Intergenic
1080158502 11:29142756-29142778 AGCTGACCTTTGAACAATGTGGG + Intergenic
1080631849 11:34084648-34084670 AGCTGACATTTGAACAACATGGG - Intronic
1082260789 11:50075119-50075141 AGCCGTCTTTTGAACAATTTGGG + Intergenic
1088249983 11:107854077-107854099 AACATACATATGAATAAATTAGG + Intronic
1088336208 11:108706926-108706948 ACCAGGCAGTTGAATAAATTAGG - Intronic
1088636401 11:111825150-111825172 AGTAGAAATTTGGACCAATTAGG - Intronic
1092664162 12:10775988-10776010 AGCCTACATTTGAACACATCTGG + Intergenic
1094083875 12:26567070-26567092 CACTGACATTTAAACAAATTGGG + Intronic
1094891722 12:34966520-34966542 AGCAGATATTTGGACCTATTTGG + Intergenic
1094934982 12:35666718-35666740 AGCAGATATTTGGACCTATTTGG + Intergenic
1094969590 12:36226885-36226907 AGCAGATATTTGGACCACTTTGG + Intergenic
1094988528 12:36532990-36533012 AGCAGACATTTGGACCTCTTTGG + Intergenic
1094998601 12:36695554-36695576 AGCAGATATTTGGACCACTTTGG + Intergenic
1095007288 12:36836741-36836763 AGCAGATATTTGGACCACTTTGG + Intergenic
1095269561 12:40201300-40201322 ATGAAAAATTTGAACAAATTAGG + Intronic
1095278829 12:40325622-40325644 ACCAGTGATTTAAACAAATTAGG + Intronic
1097739770 12:63227241-63227263 AGCATACTTTTGAATGAATTAGG + Intergenic
1098627111 12:72685279-72685301 GGCAGAATTTTGAAGAAATTTGG + Intergenic
1099006593 12:77241278-77241300 AGCAGCCATTGAAACAAATAGGG + Intergenic
1099908076 12:88795539-88795561 AGAAAACATTTAAACAATTTTGG + Intergenic
1100002326 12:89852352-89852374 AACACACATTTGAGAAAATTTGG - Intergenic
1102987935 12:117293900-117293922 GCCAGACGTTTGAACAAAGTGGG - Intronic
1105560946 13:21490217-21490239 AGAAGACATGTGAAGAAATGAGG + Intergenic
1107745668 13:43505493-43505515 GACAGACATTTGAAGAAAGTTGG + Intronic
1108874771 13:55032365-55032387 AGAAGATATTTGAACAACTCTGG + Intergenic
1110242087 13:73280344-73280366 AACATACATTTGTAGAAATTTGG + Intergenic
1111162337 13:84412008-84412030 AGCAGAGAATGGAATAAATTTGG - Intergenic
1111207354 13:85028167-85028189 GGCAGACATTGGAACAGTTTAGG - Intergenic
1111676151 13:91391228-91391250 AGCAGATATATGAAAAAAGTTGG + Intergenic
1112400667 13:99075326-99075348 AGCTGACCTTTGAACAACATGGG - Intronic
1112946084 13:104928751-104928773 AGCAGACATTGGAAGAAAGAAGG + Intergenic
1114964935 14:27945730-27945752 AGCAGACATGTGAGCAGATGTGG - Intergenic
1115405045 14:33005765-33005787 AGCCGACATTTAAAAAAATGAGG - Intronic
1116478791 14:45372474-45372496 AGCAGACATTTGAGCGAGCTTGG + Intergenic
1116965230 14:51007602-51007624 AGTAGACAGTTGAAGAAACTGGG - Intronic
1116966248 14:51018098-51018120 TGAAGACATTTGGAAAAATTAGG - Intronic
1117219110 14:53583939-53583961 AGCTGACATTTAAAATAATTTGG - Intergenic
1118089246 14:62454513-62454535 AGAAGACACATGAACAAAGTCGG - Intergenic
1118270338 14:64337774-64337796 AACAGACTTTTAAAAAAATTTGG - Intronic
1120545943 14:85811494-85811516 AGCAGAGACTTGAATAAAGTGGG + Intergenic
1120654940 14:87178166-87178188 AGGAGACATTTGAGAACATTTGG - Intergenic
1122252565 14:100450160-100450182 AGCAGACACTTGCAAAAGTTTGG - Intronic
1123797644 15:23788814-23788836 AGTAAAGATTTGAACATATTTGG + Intergenic
1123895550 15:24826104-24826126 AGAAGACATTTGAATGAAGTTGG - Intronic
1124922660 15:34041388-34041410 ACCAGACATTTGCCCAAATCAGG - Intronic
1125014914 15:34922931-34922953 AACAGACACTTGACCAAAGTAGG - Intronic
1126096167 15:45092318-45092340 CACAGACATTTGAATAAATGAGG + Intergenic
1126448257 15:48775245-48775267 GGCTGACATTTTCACAAATTTGG + Intronic
1127077252 15:55338806-55338828 AGCAACCATGTGAGCAAATTTGG + Intronic
1129327207 15:74807040-74807062 AGCAGAGTCTTGAGCAAATTTGG + Intergenic
1130230463 15:82092952-82092974 TGTGGACATTGGAACAAATTTGG + Intergenic
1130898376 15:88188340-88188362 AGCAGACATTTGACAATATCTGG + Intronic
1130906356 15:88243244-88243266 GGCAGTCATTTGAACAAATGTGG - Intronic
1131102757 15:89706155-89706177 AGCAGTCACATGAACAAACTAGG - Intronic
1131843805 15:96467734-96467756 TGCAGACCCTTGAACAAATTAGG - Intergenic
1135090970 16:19517046-19517068 ATTTGACATTTGAACAAATTAGG - Exonic
1137225228 16:46498635-46498657 AGCAGGCAATTGAATAAATGAGG - Intergenic
1138730981 16:59195031-59195053 AGCAGTCATCTGAACAAACAAGG - Intergenic
1146575042 17:33983761-33983783 AGCAGTCATTTGTACAAGTCTGG + Intronic
1146681507 17:34811563-34811585 CTCAGACATTTGAAAAAATAGGG - Intergenic
1147544369 17:41389114-41389136 AGCAGGGATTTGAACAATTCAGG + Intronic
1149312014 17:55403994-55404016 AGCAGGCATTTGGGCAATTTAGG + Intronic
1149603114 17:57905743-57905765 TCCAGACATTTGAACAAAAATGG - Intronic
1150343150 17:64385060-64385082 AGCACACATTTGCACACAATTGG - Intronic
1152414644 17:80151541-80151563 AGCCGACACTTTAACAAATCTGG - Intergenic
1152488020 17:80608231-80608253 TGCTGCCATTTGAACAAAGTGGG - Intronic
1153433647 18:5045841-5045863 AGCAGACAATCAAACCAATTAGG - Intergenic
1153472915 18:5467328-5467350 AGCAGTCATTTTTAGAAATTAGG + Intronic
1154123549 18:11670663-11670685 AGCAAACTTTTCAAGAAATTTGG - Intergenic
1154332948 18:13444577-13444599 AGCTGACCTTTGAACAATTTGGG - Intronic
1155704305 18:28789229-28789251 AGCAGACCTTTACAGAAATTAGG - Intergenic
1156092097 18:33483956-33483978 AGAAAACATTTGTATAAATTTGG - Intergenic
1158224066 18:55182310-55182332 TGAAGACATTTGAAAAAGTTTGG + Intergenic
1158232019 18:55267310-55267332 TGCAGACTTTTGAAAATATTTGG - Intronic
1158735925 18:60079314-60079336 ATAAGAACTTTGAACAAATTTGG + Intergenic
1158752442 18:60278874-60278896 TGCAGAGGTTTGAACAACTTAGG + Intergenic
1158816750 18:61107978-61108000 AAAAGACATTTGACAAAATTTGG + Intergenic
1159925563 18:74266039-74266061 AGAAGACATTTCAGTAAATTGGG - Intronic
1160358742 18:78251614-78251636 TTCAGAAATTTGAACAAGTTAGG - Intergenic
1162598607 19:11649206-11649228 AGTAGACCCTTGAACAAAGTGGG + Intergenic
1162602874 19:11682769-11682791 AGCAGACCCTTGAACAAGGTGGG + Intergenic
1163679087 19:18670242-18670264 TTCAGACATTAGAACAAATGTGG - Exonic
1166621811 19:44307841-44307863 AGCTGACCTTTGAACAAAACAGG - Intergenic
925977018 2:9148847-9148869 TAAAGACATTTGAAGAAATTAGG + Intergenic
926989646 2:18664019-18664041 TGCAGACATTTGAACATGTCTGG + Intergenic
927444517 2:23146563-23146585 ACTATACATTTGACCAAATTGGG + Intergenic
927568267 2:24134563-24134585 AAAAGACATTTGAACATTTTGGG + Intronic
929217779 2:39434678-39434700 AGCCAAAATTTGAACCAATTAGG - Intronic
929659647 2:43770893-43770915 AGCAGACAGTTGGACCATTTGGG - Intergenic
930875007 2:56205365-56205387 AGCTGACATTTGAACTAGTTTGG + Intronic
931014336 2:57959145-57959167 TGCAGAAAGTAGAACAAATTTGG + Intronic
932109564 2:68984409-68984431 AGGTGACATTTGAACAAAGACGG + Intergenic
933399299 2:81772114-81772136 AACAGTCATTTTAACAAATGTGG - Intergenic
933413425 2:81953442-81953464 AAAATACATTTAAACAAATTAGG + Intergenic
933522518 2:83391388-83391410 AGCAGATAATTGAACAAAGACGG - Intergenic
935037336 2:99391366-99391388 AGCTGACCCTTGAACAAAATGGG - Intronic
935835702 2:107050840-107050862 AGCAGACAGTTGTTAAAATTTGG + Intergenic
939456231 2:142440082-142440104 TTAACACATTTGAACAAATTTGG + Intergenic
940697989 2:157003721-157003743 ATCAGACATTTAAAATAATTTGG - Intergenic
941744932 2:169077099-169077121 AGCTGACATCTGAACAACGTGGG - Intronic
943044059 2:182837291-182837313 AGAAGAGATCTGAATAAATTAGG - Intronic
943094395 2:183411101-183411123 AGCAGAGATTTAAATAAAGTGGG - Intergenic
944246812 2:197539016-197539038 AGGATATATGTGAACAAATTTGG - Intronic
945895809 2:215480285-215480307 GGCAGTCATTTAAATAAATTAGG + Intergenic
945918194 2:215726936-215726958 ATCAAAGGTTTGAACAAATTAGG - Intergenic
946826095 2:223679505-223679527 AGCAGCCATTTGAACACTTTTGG - Intergenic
947613803 2:231541301-231541323 AGTTGACTTTTGAACAAAGTGGG - Intergenic
948073810 2:235149436-235149458 ACCACACATTTGAACAAAGCTGG + Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168856455 20:1012734-1012756 AGCAGAGATTTGGATAAAGTGGG + Intergenic
1170518891 20:17162497-17162519 AGCAAAGATTTGCACAAATATGG + Intergenic
1171048045 20:21829521-21829543 AGCAGACATTTGAAAAACATTGG - Intergenic
1171445593 20:25201687-25201709 AGCTGACCTTTGAACAACATGGG + Intronic
1173041013 20:39462562-39462584 AGCAAACATCTGAACAAAGAGGG + Intergenic
1177435907 21:21051687-21051709 AGCAGACATTTCTGTAAATTTGG + Intronic
1178626192 21:34220829-34220851 AGCAGATATCTGAACAAAATGGG + Intergenic
1182869922 22:33636991-33637013 GGCTGACATTTGAGGAAATTTGG - Intronic
1185083536 22:48723328-48723350 AGCTGACATTTAAAGTAATTTGG - Intronic
950946214 3:16949672-16949694 AGCAGAGAATTAAACAAAGTGGG - Intronic
952647254 3:35675449-35675471 AGCAGAAATATGCACAAACTGGG + Intronic
953566814 3:44039124-44039146 AGCAGCCAGTTCAACAAATAAGG - Intergenic
955709616 3:61764601-61764623 AGCAGACATCTGAACACAGAGGG + Intronic
955741566 3:62096241-62096263 AGCATGCATTTGAACCAACTTGG + Intronic
956604409 3:71058138-71058160 AGGAGACAATTGAAGGAATTGGG + Intronic
956870822 3:73416135-73416157 AGAAGAGATTAGAAAAAATTAGG + Intronic
957460024 3:80504503-80504525 AGCTGACCTTTGAACAACATGGG - Intergenic
958428690 3:94011530-94011552 AGCAGACAGTTGAGTAAATGTGG - Intronic
959634165 3:108543565-108543587 AGGAGACATTAGAACAAGTCGGG - Intergenic
959822932 3:110757750-110757772 AGCAGACCTCTGAAGAACTTGGG - Intergenic
959844338 3:111015594-111015616 AGCTGACTTTTGAACAATATGGG - Intergenic
960009211 3:112814959-112814981 AGCTGACCTTTGAACAACATGGG - Intronic
961958991 3:130834236-130834258 AACAGACATTTGAACAAATTTGG - Intergenic
962551667 3:136499152-136499174 AGCTGACCTTTGAACAACATGGG - Intronic
964137403 3:153360161-153360183 AACAGGCATTTGAACAAAAGAGG + Intergenic
965256105 3:166413776-166413798 TGGTGACATATGAACAAATTTGG - Intergenic
966304909 3:178520723-178520745 AGGTGGCATTTGACCAAATTAGG - Intronic
967430350 3:189377277-189377299 AGCAGTCTTTTCAACAAATGGGG - Intergenic
967595242 3:191320231-191320253 AGCAGACACTTGAATAAAATTGG + Intronic
969998238 4:11337125-11337147 AGCAACCATTTCAACAGATTTGG + Intergenic
970199672 4:13590905-13590927 TACAGACTTTTGCACAAATTTGG + Intronic
970291849 4:14581647-14581669 AACAGCCATTTGGACAAATTTGG - Intergenic
971313850 4:25550465-25550487 AGCAAAGATTTGAAGAAATGAGG + Intergenic
971469189 4:27001661-27001683 AGCAGACATTTGACAATTTTGGG - Intronic
971609598 4:28705863-28705885 AGCAAACATTGGAATAATTTAGG - Intergenic
971725449 4:30305908-30305930 AGTACAAATTTTAACAAATTTGG - Intergenic
971881866 4:32385236-32385258 TTCTGAAATTTGAACAAATTTGG - Intergenic
972004478 4:34082506-34082528 AGCAGTTAAATGAACAAATTAGG + Intergenic
973725995 4:53776660-53776682 AGCAGACACTTGACAAAATGGGG - Intronic
974170741 4:58263810-58263832 TGCAGACATTTTAATAAATGGGG - Intergenic
975469982 4:74754808-74754830 TGCAGACATAGGAACCAATTAGG + Intronic
976338909 4:83923251-83923273 AGCAAATGTTTGATCAAATTAGG + Intergenic
976703863 4:88001620-88001642 AAAAGAATTTTGAACAAATTGGG - Intergenic
976707982 4:88038958-88038980 CTCAAACATTTGAACAAAATGGG - Intronic
976995556 4:91428379-91428401 AGTGGACATGTGAACAAATTTGG + Intronic
977032817 4:91908324-91908346 AGCAGGCATCTGATCTAATTTGG + Intergenic
977609455 4:99017250-99017272 CGCATACATTTGGAAAAATTGGG - Intronic
977747155 4:100563041-100563063 TGCAGACAATGGAACAAAATAGG + Intronic
977806029 4:101298820-101298842 AGTAGACCCTTGAACAATTTGGG - Intronic
978111237 4:104966325-104966347 AGCTGAGATTTGAAGAAATCTGG - Intergenic
978466524 4:109014825-109014847 AGCATACAATGTAACAAATTCGG + Intronic
978674178 4:111290819-111290841 AGCAGAGATATTAACTAATTGGG + Intergenic
980487708 4:133480753-133480775 AGTGGACCTTTGAACAACTTGGG - Intergenic
980715288 4:136619285-136619307 AGCATTCATTTGAACAACTTTGG + Intergenic
981426759 4:144612221-144612243 AGCAGAGATTTGAAGAAATGAGG - Intergenic
981499636 4:145436236-145436258 AACATTCAGTTGAACAAATTTGG + Intergenic
982482242 4:155926229-155926251 AGCAGATATTAGAAGAGATTAGG + Intronic
982755191 4:159209502-159209524 AGAAGACATTTGAGCAAAGGAGG - Intronic
983738853 4:171101654-171101676 AGCAGACATAAGAAAGAATTAGG + Intergenic
984073469 4:175146646-175146668 AGCTTATATTTAAACAAATTTGG - Intergenic
984251388 4:177339650-177339672 AGCTGACCTTTGAACAACATGGG - Intronic
984723153 4:182995397-182995419 AGCTGACTTTTAAACAAAATAGG - Intergenic
985132711 4:186755420-186755442 AGGAGACATTTGAAAATATCTGG - Intergenic
986008585 5:3689929-3689951 AGAAGATATTTGAAGAAATCAGG - Intergenic
986465477 5:8017275-8017297 AGTAGACGTTTGCAAAAATTTGG + Intergenic
988497200 5:31755448-31755470 AGGTGACATTTGTACAAAATGGG - Intronic
988956623 5:36326494-36326516 AGCAGACATTTTCCCAACTTGGG - Intergenic
989993099 5:50792275-50792297 AGTATACATATGAACACATTTGG - Intronic
991343717 5:65640136-65640158 AACAGACAATGGACCAAATTTGG - Intronic
991995381 5:72381326-72381348 AACAGACATGTGAACTAATTTGG + Intergenic
992680270 5:79145863-79145885 ATCAGAAATTGGGACAAATTGGG + Intronic
992790331 5:80207938-80207960 AGCATACCTTTGAATAAAATGGG + Intronic
993267197 5:85740982-85741004 AGCAGACATTGGTACAGTTTGGG - Intergenic
993372277 5:87107617-87107639 AGCAGATATTTGACTAGATTTGG - Intergenic
993510476 5:88764833-88764855 AGTAGAAATTTTAAAAAATTAGG + Intronic
994325791 5:98443211-98443233 AGCAGAGGTTGGAACAATTTGGG - Intergenic
994675273 5:102813677-102813699 AGCAGACATTGGCAGAAATGGGG - Intronic
994728789 5:103467588-103467610 AGCAGACAGCTGAAAAAATAAGG + Intergenic
994922328 5:106063598-106063620 AACAGACATTTTAAAAAATTGGG - Intergenic
995087714 5:108134249-108134271 AGCAAACATATGAACATATATGG + Intronic
995650985 5:114368000-114368022 AGCTGACTTTTGAACAACATGGG + Intronic
995673846 5:114639809-114639831 AGCTGACCCTTGAACAACTTAGG - Intergenic
995925334 5:117367036-117367058 AGCAGACATTAGAACAATGGTGG - Intergenic
995957299 5:117793359-117793381 TGAAGACATATGAACACATTTGG - Intergenic
996557590 5:124795118-124795140 AGTTGACACTTGAACAACTTGGG + Intergenic
999497558 5:152114843-152114865 AACAGTGACTTGAACAAATTAGG + Intergenic
1000588839 5:163133587-163133609 AGCAGACAGTTGAATAGATTTGG + Intergenic
1000952617 5:167502829-167502851 AGCAGACATTTTTATATATTTGG - Intronic
1001538372 5:172516927-172516949 AAAACACACTTGAACAAATTTGG + Intergenic
1002857288 6:1049582-1049604 AACAGTCATTTGAAGAACTTTGG - Intergenic
1003356218 6:5373808-5373830 TGCAATCATTTGAAGAAATTGGG - Intronic
1004460469 6:15830487-15830509 AACTGACTTCTGAACAAATTTGG + Intergenic
1004611675 6:17247306-17247328 AGAAGACCTCTGAAAAAATTCGG + Intergenic
1008047057 6:46862077-46862099 AGTAGAGATTTTAATAAATTTGG + Intronic
1009702198 6:67199318-67199340 TGTAGAAATTTGAAGAAATTGGG - Intergenic
1011057625 6:83222967-83222989 AGCAGAAATTAGATCAAAATAGG - Intronic
1011388829 6:86828418-86828440 AACAGATATTTGTACATATTTGG + Intergenic
1013150128 6:107437772-107437794 AGTTGACCTTTGAACAAAATGGG - Intronic
1014105708 6:117558366-117558388 TGCAGACATTTGAAAAATGTGGG - Intronic
1014600284 6:123402987-123403009 AGTAGACATTTGAAGAAAGGAGG + Intronic
1014919074 6:127191269-127191291 AGTATATATTTGAAGAAATTGGG + Intronic
1015686836 6:135873319-135873341 AGCAGACACTTGAAGATATTGGG - Intronic
1016221352 6:141674270-141674292 AACTGACATCTGAACAAAATTGG + Intergenic
1016494457 6:144644256-144644278 ATCAGCCATTTGAACAAATCAGG - Intronic
1016647574 6:146427504-146427526 AGCAGACATTTGAACAAATTGGG - Intronic
1017818788 6:158033991-158034013 AGCTGACAGATGAACAAATAGGG + Intronic
1018063577 6:160109503-160109525 ACCAGACATTTCTACAAATGAGG + Intronic
1018715087 6:166525876-166525898 AGGAGATACTTGAACAACTTGGG + Intronic
1019557891 7:1641651-1641673 AACCGACATTTTAGCAAATTAGG - Intergenic
1020815229 7:12897106-12897128 AACAAACATTTCAATAAATTTGG - Intergenic
1020839629 7:13199433-13199455 GGCAAACGTTTGAACAATTTGGG - Intergenic
1022106869 7:27202962-27202984 TGCAGACATTTGAAAACAGTGGG - Intergenic
1022792362 7:33701742-33701764 AACTGACAGTTGAACAACTTGGG - Intergenic
1023499790 7:40835396-40835418 AGAAGAAATTTGAAGAATTTGGG - Intronic
1024331124 7:48156338-48156360 ATCAGACCTGTGTACAAATTTGG + Intergenic
1027144368 7:75683743-75683765 AACAGACCCTTTAACAAATTGGG - Intronic
1027821043 7:83045062-83045084 AGCAGACATTTCATCTGATTAGG + Intronic
1028644123 7:93076586-93076608 ACCAAACATATGAGCAAATTTGG - Intergenic
1030311163 7:108070811-108070833 AGATGACTTTTGAACAATTTGGG - Intronic
1031332073 7:120478095-120478117 AGCAAACATTTGGAGTAATTTGG + Intronic
1031570301 7:123350907-123350929 AGCAAACCTTTGAACATACTGGG + Intergenic
1034362889 7:150516358-150516380 AGCAGATATTTGAACAAGACTGG - Intronic
1034740438 7:153468457-153468479 AGTAGAGATTTGAACAAATGAGG + Intergenic
1034878223 7:154743958-154743980 AGCAGACCCTTGAACAATATAGG - Intronic
1035856727 8:2983786-2983808 AACACACATAAGAACAAATTTGG - Intronic
1038834252 8:31101310-31101332 AGAAGACATTCGGACAAATATGG - Intronic
1041419880 8:57654719-57654741 ATCAGAAATTTGGAAAAATTGGG + Intergenic
1041783126 8:61600189-61600211 AACACACTTCTGAACAAATTAGG + Intronic
1042536272 8:69861728-69861750 AGCAGAGATTTTCCCAAATTTGG + Intergenic
1043408600 8:79967438-79967460 AACAGACATCTGAACAAAGCTGG - Intronic
1043505106 8:80894838-80894860 AGGAGACAAATGAACAAAATGGG + Intergenic
1044774197 8:95670566-95670588 AGTAAACATTAGGACAAATTGGG + Intergenic
1045763336 8:105637021-105637043 AGCATACATTTGTCCAACTTAGG + Intronic
1045979157 8:108163635-108163657 AGCAGGCATTAAAACAAATAAGG - Intergenic
1046456410 8:114469756-114469778 AACAGACATTAGAGCAAACTAGG - Intergenic
1047606394 8:126478723-126478745 AGCAGACACTGAAACAAAATTGG - Intergenic
1047818936 8:128496964-128496986 AGGGGAAATTTGTACAAATTAGG - Intergenic
1049050624 8:140192032-140192054 AGCAAAAATTTGAAAAAATATGG + Intronic
1049677569 8:143898699-143898721 AGCAGACATTTAAAACAATATGG + Intergenic
1050764773 9:9118703-9118725 AGCTGATAATTGAACAAATAAGG + Intronic
1051040154 9:12799578-12799600 GGAAGACATTTTAAAAAATTAGG + Intronic
1051345783 9:16149811-16149833 AGCAGAAATGTGAATAAATCAGG - Intergenic
1053038928 9:34852358-34852380 AGTTGACATTTGAACAATGTAGG - Intergenic
1055172508 9:73276256-73276278 GACAGACATATGAACCAATTAGG - Intergenic
1055574818 9:77650172-77650194 AGTAAACATGTGAATAAATTTGG + Intergenic
1056906468 9:90654370-90654392 AAGAAACATTTGAAAAAATTAGG + Intergenic
1057558300 9:96107025-96107047 AGTTGACACTTGAACAAAGTAGG + Exonic
1057620406 9:96629612-96629634 AGCATACATTTGGGCAGATTAGG + Intergenic
1058040655 9:100298086-100298108 AGAAGACATTAGAACAGATATGG + Intronic
1058316403 9:103572129-103572151 AATACAGATTTGAACAAATTTGG + Intergenic
1059153924 9:111973324-111973346 CCCAGACATTTGCAAAAATTTGG + Intergenic
1059911367 9:119047896-119047918 AGCTGACACTTGGACAAACTAGG - Intergenic
1061804815 9:133132005-133132027 AACAGACATTTGATCAATGTTGG + Intronic
1186016626 X:5202517-5202539 AGTAGACCCTTGAACAAAATGGG - Intergenic
1186365010 X:8882919-8882941 AACAGACCTTTGAAAACATTTGG - Intergenic
1186637141 X:11418807-11418829 AAGAGACATTTGAAGCAATTTGG + Intronic
1186939644 X:14491439-14491461 AGTAGAAATTTGAAAACATTGGG + Intergenic
1186994768 X:15108176-15108198 AGGAAACATTTGACCAAAATGGG - Intergenic
1188021019 X:25157603-25157625 ACCAGACATTTCTATAAATTGGG - Intergenic
1188299525 X:28490281-28490303 AGCAGCTATCTGAACACATTTGG - Intergenic
1193046190 X:77057295-77057317 GGCTGATAATTGAACAAATTTGG - Intergenic
1193571478 X:83150182-83150204 AGCAGACAGTGGGATAAATTTGG + Intergenic
1197008057 X:121527523-121527545 AACAGATATTTGAACAAAAAAGG + Intergenic
1199481836 X:148306290-148306312 AGTTGACACTTGAACAACTTAGG - Intergenic