ID: 1016650662

View in Genome Browser
Species Human (GRCh38)
Location 6:146455964-146455986
Sequence CAGAGCAAAGAGCAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016650659_1016650662 4 Left 1016650659 6:146455937-146455959 CCTGAGGTCATAGATGGATCTTT No data
Right 1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016650662 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG Intergenic
No off target data available for this crispr