ID: 1016658228

View in Genome Browser
Species Human (GRCh38)
Location 6:146544435-146544457
Sequence GCAGCCTTCTCAACTAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016658228_1016658232 -8 Left 1016658228 6:146544435-146544457 CCAGGACTAGTTGAGAAGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1016658232 6:146544450-146544472 AAGGCTGCTTTGGAGCGGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 181
1016658228_1016658236 23 Left 1016658228 6:146544435-146544457 CCAGGACTAGTTGAGAAGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1016658236 6:146544481-146544503 AGCCTCAACTCAAGTTCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 100
1016658228_1016658239 29 Left 1016658228 6:146544435-146544457 CCAGGACTAGTTGAGAAGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1016658239 6:146544487-146544509 AACTCAAGTTCAGAGGGATTGGG No data
1016658228_1016658235 22 Left 1016658228 6:146544435-146544457 CCAGGACTAGTTGAGAAGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1016658235 6:146544480-146544502 CAGCCTCAACTCAAGTTCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 123
1016658228_1016658238 28 Left 1016658228 6:146544435-146544457 CCAGGACTAGTTGAGAAGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1016658238 6:146544486-146544508 CAACTCAAGTTCAGAGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016658228 Original CRISPR GCAGCCTTCTCAACTAGTCC TGG (reversed) Intronic