ID: 1016661499

View in Genome Browser
Species Human (GRCh38)
Location 6:146586174-146586196
Sequence ATCTGAGGCTAGGAGTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016661499_1016661504 14 Left 1016661499 6:146586174-146586196 CCCATCTACTCCTAGCCTCAGAT No data
Right 1016661504 6:146586211-146586233 TTCTCAAGACTTCAGACTCTAGG No data
1016661499_1016661505 15 Left 1016661499 6:146586174-146586196 CCCATCTACTCCTAGCCTCAGAT No data
Right 1016661505 6:146586212-146586234 TCTCAAGACTTCAGACTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016661499 Original CRISPR ATCTGAGGCTAGGAGTAGAT GGG (reversed) Intergenic
No off target data available for this crispr