ID: 1016667477

View in Genome Browser
Species Human (GRCh38)
Location 6:146658677-146658699
Sequence GTGAATAATCAGTATGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016667477 Original CRISPR GTGAATAATCAGTATGATTA AGG (reversed) Intronic
903851709 1:26310993-26311015 GTGGATATTCAGTCTGATGATGG + Intronic
905056452 1:35098332-35098354 GTGAAGAATCAGTGTCATTTTGG + Intronic
908097285 1:60752249-60752271 CTGAAAAATAAGTATAATTAGGG - Intergenic
910130197 1:83895477-83895499 ATTAATAATATGTATGATTATGG - Intronic
910539461 1:88339278-88339300 CTGAATAATAATCATGATTATGG + Intergenic
911047659 1:93641966-93641988 GAAAATAATGAGTGTGATTATGG + Intronic
912899432 1:113631735-113631757 TTTAATAACCAGTAAGATTAAGG - Intronic
913008437 1:114658256-114658278 GAGAATATTCATCATGATTAGGG + Intronic
913238655 1:116807901-116807923 ATGAATAATTAGTATGGTTTAGG - Intergenic
916524595 1:165597982-165598004 GTGAATAATAAGAATGCTTTGGG + Intergenic
918032960 1:180834487-180834509 TTGAAAAGTCAGTATGAATATGG + Intronic
1063202582 10:3798218-3798240 GTGAATATTCAGGATGGTTATGG + Intergenic
1064700551 10:18015702-18015724 GAGAAGAATCATCATGATTATGG - Intronic
1068181237 10:53520962-53520984 GTGATTATGGAGTATGATTATGG - Intergenic
1069657294 10:70099368-70099390 ATGAATCATCATTATTATTATGG - Intronic
1071102220 10:82052152-82052174 ATGAATATTCAGTTTGTTTAGGG + Intronic
1074793584 10:116917756-116917778 CTGAATTATCACTATGATTCTGG - Intronic
1076609290 10:131711023-131711045 GTGCATAATGAGTATGAGCAAGG - Intergenic
1076920369 10:133449715-133449737 GTGAATAATCAGAATATATAAGG + Intergenic
1077772309 11:5233446-5233468 TTGATTAATCAGTGTGATGATGG + Intronic
1078483272 11:11699019-11699041 GTGAGTAATCATTATGCTTCGGG + Intergenic
1081291630 11:41333298-41333320 CTGAGTATGCAGTATGATTAAGG - Intronic
1085140319 11:74134713-74134735 GTAAATAATGAGTAAGACTATGG - Intronic
1085653960 11:78295390-78295412 TTGAATAATGAATATGATCAGGG - Intronic
1086374403 11:86185562-86185584 GTCTAAAATTAGTATGATTAAGG + Intergenic
1088433278 11:109782164-109782186 GTGAAGAATAAGTGTGATAATGG - Intergenic
1089762288 11:120736599-120736621 ATGAATAATTAGAATAATTATGG + Intronic
1091112825 11:132986371-132986393 GTGAAGAAACAGAATAATTAAGG + Intronic
1092818378 12:12330839-12330861 TTGAATAATCTGTGTGATGATGG + Exonic
1095157833 12:38880191-38880213 GTCAATAAACAGAATGATTCTGG + Intronic
1095244567 12:39904036-39904058 GTGTATAATCAGTAAGACTGAGG - Intronic
1095582611 12:43817343-43817365 GAGAATAATGAGGATGATTTAGG + Intergenic
1098670408 12:73221396-73221418 GGGAAAAATCAGTATAATTTTGG + Intergenic
1099451514 12:82813491-82813513 GAGAATAAGCAGAATGGTTAAGG - Intronic
1100369374 12:93953259-93953281 ATAATTAATCAGTATGATAAAGG + Intergenic
1101081428 12:101189325-101189347 GTGAAAAATCTATATGAATATGG - Intronic
1103144667 12:118584378-118584400 TTGAATAACCAGTATGATACAGG - Intergenic
1104041098 12:125131560-125131582 ATGAATAATGAGTATGAATATGG + Intronic
1107064987 13:36203665-36203687 AAGAATAATCAGTCTTATTAAGG - Intronic
1107369061 13:39722370-39722392 GTGAATAATCAGAACAAGTATGG - Intronic
1109137262 13:58668951-58668973 GTGAATAATCACTGTGAACAAGG + Intergenic
1109160853 13:58972180-58972202 GTGAATCATCAGTGTGACAATGG - Intergenic
1109899094 13:68739526-68739548 GTTAAAAATAAGTTTGATTAGGG - Intergenic
1110341679 13:74399238-74399260 GTGAAAAATAAGTTTTATTATGG + Intergenic
1111072763 13:83189549-83189571 GTGTATTATCAGTATGACTGAGG - Intergenic
1111284057 13:86065030-86065052 GAGAATAACCAGTATTATTAAGG - Intergenic
1111569580 13:90065167-90065189 ATGAGTGATCAGTATGATTCAGG + Intergenic
1111721191 13:91947216-91947238 TTGAATCCTCAGTATGAATAAGG - Intronic
1111775300 13:92653941-92653963 GAGAATATTCAGCATGACTAGGG + Intronic
1111872453 13:93849875-93849897 GTGAATTATTAGAATTATTAAGG + Intronic
1114522974 14:23350423-23350445 GGGAATAATCAGTAAGGATAAGG + Intronic
1116612701 14:47097389-47097411 TGGAATAATAAGCATGATTAAGG + Intronic
1117895128 14:60476264-60476286 ATGAATATACAGTATGAATAGGG - Intronic
1118237820 14:64026090-64026112 GTAAATAATCAGAATCATTTGGG + Intronic
1118522938 14:66607091-66607113 ATGAATAATAAGAATGAATAAGG + Intronic
1124969062 15:34466652-34466674 GAGAATATTCAGCATGACTAGGG + Intergenic
1125396316 15:39251970-39251992 TTGAATAATAACTATGATTCTGG - Exonic
1125807623 15:42507669-42507691 GAGAATAATAAATATGAGTAAGG + Intronic
1130573198 15:85067413-85067435 GTGAATAATAAGAATTATTAAGG + Intronic
1132190221 15:99848768-99848790 GAGAATATTCAGCATGACTAGGG - Intergenic
1133488681 16:6246036-6246058 CTGAATAATCAGAATTATTGTGG + Intronic
1134863972 16:17588233-17588255 GAGAATAAACAGTTTGTTTAGGG - Intergenic
1139349166 16:66324686-66324708 GAGAATCATCAGGGTGATTAAGG - Intergenic
1139369158 16:66455281-66455303 GTGAATAATCATCCTGATTTGGG - Intronic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1149333906 17:55614764-55614786 GTGAGTAATATGTATGAGTAGGG - Intergenic
1150189453 17:63222702-63222724 GTGTTTAATCAGTTTTATTAAGG - Intronic
1150600593 17:66647377-66647399 GTGAATATTCAGTTTAATTATGG + Intronic
1153550862 18:6260383-6260405 GGGAAGAATCAATATCATTAAGG - Intronic
1155134491 18:22975022-22975044 CTGAATAAACATTATGATTTAGG + Intronic
1158937633 18:62379291-62379313 GTGAATAATCAGTGTGCTATGGG - Intronic
1168460309 19:56549758-56549780 TTGAATAATTTGTATGAATATGG + Intronic
926868133 2:17382059-17382081 GTGAGTAATCTGTATCATTTTGG - Intergenic
929237446 2:39621175-39621197 GTGAATTTTCAGTATGTTTGTGG + Intergenic
929359258 2:41064501-41064523 AATAATAATCACTATGATTATGG + Intergenic
932880289 2:75494916-75494938 GTTAATGATCAGTATGCTTAGGG + Intronic
933060220 2:77727340-77727362 GTGAATAATCAGAATGTTGAGGG - Intergenic
940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG + Intronic
941199058 2:162486893-162486915 GTGAAAAATTAGCATGTTTAAGG - Intronic
941470246 2:165876032-165876054 ATGATTTATCAGTATGTTTAGGG - Intronic
944274106 2:197816260-197816282 GCTCATAATCATTATGATTATGG + Intronic
944560905 2:200936527-200936549 GTGACTTAACAGTATCATTAAGG - Intronic
945449828 2:209980859-209980881 GGGAATAATCAATAGGATTTGGG + Intronic
1172926759 20:38544384-38544406 GAGAATAACCAGGATGATAAAGG - Intronic
1174018034 20:47504827-47504849 GTGCATTAGCAGTATGATTCTGG + Intronic
1174105412 20:48158700-48158722 GGGAATAATAAGTTTGATTTTGG - Intergenic
1174416118 20:50368357-50368379 GTAAATAAGAAGTATGATCAGGG - Intergenic
1176705386 21:10114307-10114329 GTGATTATTCATTATGATCAAGG - Intergenic
1178077976 21:29030279-29030301 GAGAATCATAAGTATGATAAAGG + Intronic
1179333481 21:40427921-40427943 CTGATTAATCAGTATCATTTGGG - Intronic
1182504707 22:30773443-30773465 GTGAATAATCAGTGCAACTAGGG - Intronic
950761259 3:15230262-15230284 GTAAATAAGCACTTTGATTAGGG + Intronic
951175929 3:19599906-19599928 ATTAATAATCAGTATGTATAAGG + Intergenic
951426181 3:22547635-22547657 GTGAATTATCCTTATGATTGTGG + Intergenic
951477991 3:23129015-23129037 GTGAATATTCAGTAAGATCCAGG + Intergenic
952078911 3:29732922-29732944 GTGAATAAGCAATATCATAAGGG - Intronic
952224100 3:31356685-31356707 ATGATTAATCAGGATAATTAGGG - Intergenic
954596269 3:51827862-51827884 CTGAATAATGAGAATTATTATGG - Intronic
955993886 3:64658034-64658056 GTGGATATTCAGTAGTATTAGGG - Intronic
956139281 3:66129312-66129334 CTGAATCATCTGTATGATTTTGG - Intergenic
956990524 3:74757639-74757661 TTGAATAATCTGAATAATTAGGG + Intergenic
958187668 3:90143936-90143958 GTAAATAATCAGTGTGGCTAGGG - Intergenic
959301370 3:104606425-104606447 GCTAAGAAACAGTATGATTAAGG + Intergenic
959625920 3:108450734-108450756 ATGATTAATCAGTTTGATTGTGG + Intronic
961259544 3:125590102-125590124 GTGAATATTCACTATGAAAAAGG + Intronic
962644929 3:137428803-137428825 GTCATTAATCATTATGAATACGG - Intergenic
963961987 3:151319865-151319887 TTGAAAAATCAGTAAGATTACGG - Intronic
966463974 3:180208790-180208812 GTCTATAGTCAGTATTATTAGGG - Intergenic
966934958 3:184700445-184700467 GTAAATAATCGGTAAGACTAAGG - Intergenic
967336199 3:188347518-188347540 GTGAAAACTCAGTATGATCAGGG - Intronic
971182316 4:24340497-24340519 GTGTTTAATCAGTGTAATTATGG - Intergenic
971747128 4:30597154-30597176 TTGAATTATCAGTATGAATTTGG - Intergenic
973802040 4:54487792-54487814 GTGAAAAAGGAGAATGATTATGG - Intergenic
974319293 4:60324163-60324185 GTGAAAAATCCTTTTGATTATGG + Intergenic
974639251 4:64608010-64608032 GTGAATAAAAAATATCATTAGGG + Intergenic
975444962 4:74452834-74452856 GTGTTTAATAAGTATTATTAGGG + Intronic
975923428 4:79420423-79420445 TTGATTATTCAGTATGATTTTGG + Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
978345112 4:107758959-107758981 TTGAATATTCAGTCTGATAATGG - Intergenic
978730201 4:112017370-112017392 GGGAATATTCAATATGAATAAGG - Intergenic
979746347 4:124218219-124218241 GTGAATAATGAATGTGATTTTGG - Intergenic
980377649 4:131970993-131971015 GTGATTATTCATTATGATCAAGG - Intergenic
980537162 4:134141546-134141568 GTGAGTAATCTGTATGTTTCAGG + Intergenic
980686169 4:136232320-136232342 TTTAATTATCAGTATGATTATGG + Intergenic
980853315 4:138410307-138410329 TTGAATAATCAGAATAATGATGG + Intergenic
981419814 4:144536422-144536444 ATGAATAATAATAATGATTATGG - Intergenic
981674135 4:147321547-147321569 TTGACTAATCAGTATGTCTATGG - Intergenic
983472837 4:168177429-168177451 GTGGATACTCAGTTTGATAAGGG + Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984252768 4:177354341-177354363 ATTGATAAGCAGTATGATTATGG - Intronic
984660650 4:182371142-182371164 GTGAATAATGAAAATGACTAGGG - Intronic
986140157 5:5022072-5022094 GTGAAAAATCACTCTGATTTTGG - Intergenic
991588528 5:68224274-68224296 GTGAATATTCAATTTGATTCTGG + Intronic
994283283 5:97932411-97932433 GAGAATAACAAGTATGCTTATGG + Intergenic
995870536 5:116739191-116739213 GTCAAGAATCAGGAAGATTATGG - Intergenic
999599360 5:153243999-153244021 GTGGATAATCAGTATTTGTAAGG - Intergenic
1000882868 5:166717325-166717347 CTGAGTAAACCGTATGATTAAGG - Intergenic
1004710372 6:18164538-18164560 GTGAATAATGAATATTATCAGGG - Intronic
1007158038 6:39765008-39765030 GGGAAAAATCAGTTAGATTAGGG - Intergenic
1009513069 6:64577537-64577559 GTTAAAAATCACTATGATCAGGG + Intronic
1010397078 6:75404818-75404840 GTGAATCAAAAGTATGATTTTGG - Intronic
1011364076 6:86561483-86561505 GTGAATGCTCAGTATGGATAGGG - Intergenic
1011746111 6:90409415-90409437 CTGAATAGTGAGTATGATGAAGG + Intergenic
1013205915 6:107945773-107945795 CTGAATAAAAAGTATGATTAAGG + Intronic
1013554028 6:111237892-111237914 GTGAATAAACACTATGGTGATGG + Intergenic
1016596435 6:145807286-145807308 GATAATAATCAATATGAGTAGGG + Intronic
1016667477 6:146658677-146658699 GTGAATAATCAGTATGATTAAGG - Intronic
1017182737 6:151569358-151569380 TTTAATAAACAATATGATTATGG - Intronic
1017318352 6:153058982-153059004 GTGAATAATTACTAAGAATATGG + Intronic
1020511485 7:9062278-9062300 GTGAATAGAAACTATGATTAAGG - Intergenic
1021264017 7:18496497-18496519 GTGCATATTCAGTCTGCTTAGGG + Intronic
1021494330 7:21257725-21257747 GTGAATAATTTTTATAATTAGGG - Intergenic
1027686939 7:81289921-81289943 GGGAATTATCAGAATGAATATGG - Intergenic
1028431767 7:90755658-90755680 ATGAATAGTCAGCATGATAAGGG + Intronic
1032275615 7:130452697-130452719 GTGAATGACCAGTATGCTAAAGG - Intergenic
1034467098 7:151236327-151236349 GTGAACACTGAGTATGGTTAAGG + Intronic
1035897752 8:3423139-3423161 TTAAATAATCAGTTTAATTAAGG + Intronic
1035903989 8:3489327-3489349 ATGAATAGTCAATATTATTAGGG - Intronic
1042688667 8:71471121-71471143 GTGAAATATCAGTTTTATTATGG - Intronic
1043005749 8:74815996-74816018 GTGAAACATGAGTATGATCATGG + Intronic
1044506294 8:93024003-93024025 GAGAACAATGATTATGATTATGG + Intergenic
1045204871 8:100027900-100027922 TGGAATAAACAGTATTATTAGGG - Intronic
1046014007 8:108584192-108584214 GTGAACAGGCAGTATGATTTGGG + Intergenic
1050184743 9:2960866-2960888 GTGAGTAACCAGTATAACTATGG + Intergenic
1050866362 9:10505173-10505195 GTGATTTCTCAATATGATTAAGG + Intronic
1051243360 9:15083680-15083702 ATGAATAATGAGTATGGTTGGGG - Intergenic
1051599235 9:18855682-18855704 GTGAAAATCCATTATGATTATGG + Intronic
1053642669 9:40101418-40101440 GTGATTATTCATTATGATCAAGG - Intergenic
1053763484 9:41364072-41364094 GTGATTATTCATTATGATCAAGG + Intergenic
1054323525 9:63698669-63698691 GTGATTATTCATTATGATCAAGG - Intergenic
1054542095 9:66275238-66275260 GTGATTATTCATTATGATCAAGG + Intergenic
1059621939 9:116015447-116015469 GTGAACATTCAGAATGATAATGG - Intergenic
1059870765 9:118571780-118571802 GTGAATATAAAGTATAATTATGG + Intergenic
1059897593 9:118884438-118884460 GTTAATAATCATTAGGTTTACGG + Intergenic
1062251642 9:135599778-135599800 GTGAAAAAGCAGTACAATTAAGG + Intergenic
1202790420 9_KI270719v1_random:84404-84426 GTGATTATTCATTATGATCAAGG - Intergenic
1186499558 X:10040471-10040493 GTGAGTAAAAAGTATGATAAAGG + Intronic
1189560921 X:42190832-42190854 GTGAATTAACAGAATGAATAGGG - Intergenic
1190545274 X:51519124-51519146 GTAATTAATCAGTTTGATTAAGG + Intergenic
1193622046 X:83765486-83765508 GTGTATAATGTGTATGTTTATGG - Intergenic
1199074389 X:143512234-143512256 GTGGATAATGAGGATGAGTAGGG - Intronic
1199214943 X:145252665-145252687 GTGGATAATGAGGATGAGTAGGG + Intronic
1200270169 X:154675307-154675329 TTGAAAAATCAGTGTGATTGTGG + Intronic