ID: 1016668903

View in Genome Browser
Species Human (GRCh38)
Location 6:146677705-146677727
Sequence TCATTCCAACACATAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016668899_1016668903 9 Left 1016668899 6:146677673-146677695 CCTTCCTTCTCCTGCTGAACTTA 0: 1
1: 0
2: 4
3: 33
4: 323
Right 1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG 0: 1
1: 0
2: 2
3: 13
4: 207
1016668900_1016668903 5 Left 1016668900 6:146677677-146677699 CCTTCTCCTGCTGAACTTACAGT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG 0: 1
1: 0
2: 2
3: 13
4: 207
1016668902_1016668903 -1 Left 1016668902 6:146677683-146677705 CCTGCTGAACTTACAGTTAAGGT 0: 1
1: 0
2: 1
3: 4
4: 100
Right 1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG 0: 1
1: 0
2: 2
3: 13
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016668903 Original CRISPR TCATTCCAACACATAGAATG TGG Intronic
900887519 1:5425698-5425720 TTATCCCAACACATCGGATGTGG - Intergenic
902220967 1:14964773-14964795 TCATTCAAACACAAAGACGGTGG - Intronic
904224342 1:29002756-29002778 TCATTCTACAAAATAGAATGAGG + Intronic
904902313 1:33867068-33867090 TTCTTCTAACCCATAGAATGTGG + Intronic
905874025 1:41420917-41420939 TCATAGCAACACATAGAAGCTGG + Intergenic
906373340 1:45273309-45273331 TCCTTCTAACAAATAGACTGTGG - Intronic
908103294 1:60813305-60813327 TCATTCCAAGACCTGGAATCTGG + Intergenic
909324217 1:74329235-74329257 TCATGCCAAAACACAGAAAGAGG - Intronic
909666096 1:78134941-78134963 TGGTTCCAAGACATAGAATATGG + Intronic
910122428 1:83805075-83805097 TGATCCCAACAAATAGAATGTGG - Intergenic
910436481 1:87210804-87210826 AGATGCCAACACATAGAAGGTGG + Intergenic
910468588 1:87526382-87526404 TCTTTCAATCACATATAATGTGG - Intergenic
911938008 1:104005582-104005604 ACATTCTAACCAATAGAATGTGG + Intergenic
912128073 1:106565137-106565159 ACATTCCATGGCATAGAATGGGG + Intergenic
914705394 1:150166043-150166065 GGATTCCAACACGCAGAATGGGG + Intergenic
916646551 1:166792324-166792346 TCCTTACACCACATGGAATGTGG - Intergenic
916988577 1:170217875-170217897 ATATTCCAAGAGATAGAATGAGG - Intergenic
917176154 1:172237947-172237969 TCATTCCAACAGAATGAAAGTGG - Intronic
917485002 1:175447835-175447857 TCATTCCAACACATGTAATGTGG + Intronic
917906897 1:179593717-179593739 TCATTCCAATACATGCAATATGG + Exonic
922738730 1:228004237-228004259 ACATTCCAACACTTGGAACGGGG - Intergenic
923119287 1:230976109-230976131 TCAATCCAGCACATATACTGAGG - Intronic
924467177 1:244309170-244309192 TCATTCTATTATATAGAATGAGG - Intergenic
924879296 1:248141627-248141649 TAATTACAACAGATACAATGTGG + Intergenic
924938130 1:248789641-248789663 TCATTCTATCTTATAGAATGAGG - Intergenic
1062988585 10:1794016-1794038 TAAAACCAACACATAGAATACGG + Intergenic
1068365464 10:56044056-56044078 TCTCTCCTACACATAGAAGGAGG - Intergenic
1068718096 10:60210702-60210724 CCATTCCCACACACACAATGGGG + Intronic
1070075010 10:73126515-73126537 TCATTCCAACAATAAGAATCAGG - Intronic
1070512357 10:77173042-77173064 TCATTTCAACACATACATTTGGG + Intronic
1072041325 10:91609478-91609500 TCATTCCCATATATAGAATTGGG + Intergenic
1072120848 10:92404549-92404571 TCATGCCAACACTTAGCACGTGG - Intergenic
1072158475 10:92745058-92745080 TACTTCTAACAAATAGAATGTGG - Intergenic
1074862923 10:117525889-117525911 TGATGCCAACACATAAAAGGTGG - Intergenic
1074893527 10:117755342-117755364 TCATTACGACCCAGAGAATGGGG + Intergenic
1075396151 10:122128953-122128975 TCATTGATACACATAAAATGTGG + Intronic
1075808357 10:125206095-125206117 TCTTTCCAACACATTTAATCAGG - Intergenic
1076052270 10:127345378-127345400 CCAGTCCCACACCTAGAATGTGG + Intronic
1080138048 11:28881057-28881079 TCATTCCATCAGATAGATAGTGG + Intergenic
1081207061 11:40288671-40288693 TCATTAGAATATATAGAATGAGG - Intronic
1081341881 11:41938066-41938088 TCATCCCAGCTCATTGAATGTGG + Intergenic
1081982473 11:47276685-47276707 TCACTCCAAAACATAAAATATGG - Intronic
1082677597 11:56126688-56126710 TCATTGAAACAAATAGAATTTGG + Intergenic
1086803401 11:91206824-91206846 TGATGCCAACACATAGAACTTGG + Intergenic
1088717175 11:112559083-112559105 TGATTCTAACAATTAGAATGTGG - Intergenic
1091356281 11:134940343-134940365 TTATTTGAACACCTAGAATGGGG - Intergenic
1091563633 12:1632210-1632232 TCACTCCTACTCATTGAATGAGG + Intronic
1091779211 12:3203283-3203305 TCATTCACAAACATATAATGAGG - Intronic
1091929038 12:4379781-4379803 TGATTACAACACAGAGGATGTGG - Intergenic
1091994194 12:4980063-4980085 TCACTCCATGACATAGATTGAGG - Intergenic
1093328632 12:17809444-17809466 TTATTCCAGGACAAAGAATGGGG - Intergenic
1093842054 12:23915841-23915863 TAAGTCCTGCACATAGAATGAGG - Intronic
1094054559 12:26256054-26256076 ACAGTCCAACACATGGACTGTGG + Intronic
1095321644 12:40835635-40835657 TCAATCCCACACACAGAATCAGG + Intronic
1095405613 12:41863852-41863874 TCATTCCAAGACACAGCATTAGG + Intergenic
1095731775 12:45513318-45513340 TATTTCCAACACATAAAATTTGG + Intergenic
1098554092 12:71799113-71799135 ACATTCCAACCCCTAGATTGTGG + Exonic
1098851710 12:75603802-75603824 GAATTCTAACACATAGAATCAGG - Intergenic
1099638676 12:85253480-85253502 ACCTTTCAACACAAAGAATGTGG + Intronic
1099708261 12:86185073-86185095 TCATTCTAATTTATAGAATGTGG + Intronic
1102216227 12:111163328-111163350 TCATTGCAACACAGACCATGCGG - Intronic
1106371665 13:29140574-29140596 TCATACCATCACTTAGAATGAGG - Intronic
1109471228 13:62807067-62807089 TCCTTCCAACAAATACAATATGG + Intergenic
1109964793 13:69678309-69678331 CCATTCCAAAAAATAAAATGTGG - Intergenic
1111392002 13:87608625-87608647 TCATTCCAACCCATGGGAGGGGG - Intergenic
1111454157 13:88457332-88457354 TCATTCCAAAGCATGAAATGGGG + Intergenic
1115069569 14:29304427-29304449 TCCTTCCTACACATTCAATGAGG - Intergenic
1115501974 14:34058344-34058366 TATTTTCAAGACATAGAATGTGG + Intronic
1117728922 14:58702042-58702064 TCCTTCTAACTAATAGAATGTGG - Intergenic
1118580240 14:67288713-67288735 AGATTCCATCACATACAATGAGG - Intronic
1120982016 14:90298639-90298661 TGATTCCAACACACAAAATATGG + Intronic
1124137005 15:27043634-27043656 TCATTCTATCTCATGGAATGAGG + Intronic
1130925174 15:88380138-88380160 TACTTCCAACAAATAGAATGTGG + Intergenic
1131246328 15:90796932-90796954 TCTTTCCAACTCATACCATGTGG - Intronic
1135613528 16:23889178-23889200 TCATTACACTACATTGAATGTGG - Intronic
1138633459 16:58317800-58317822 TTCTGCCAAAACATAGAATGGGG + Intronic
1139132515 16:64163471-64163493 TCATTCCCAAACATAGTATAGGG + Intergenic
1140604970 16:76524723-76524745 ACATTTCAACACATACAGTGAGG - Intronic
1142607939 17:1092253-1092275 TCCTTCCAAGAAACAGAATGTGG + Intronic
1143362527 17:6383568-6383590 TCATTACAACACTTAGGATTTGG + Intergenic
1145403812 17:22569125-22569147 TCTTCCCAACACAGAGCATGAGG + Intergenic
1146522232 17:33534813-33534835 GCATTCATACACAGAGAATGAGG - Intronic
1155286667 18:24295633-24295655 TTATCCCAGCACATAGACTGGGG + Intronic
1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG + Intronic
1156560493 18:38119884-38119906 ACATTTTAACACATAGAATAGGG - Intergenic
926316371 2:11713268-11713290 TCAAACAAACACAAAGAATGTGG - Intronic
926558805 2:14392616-14392638 TCATTCTTACACTTAGAAAGGGG - Intergenic
927837663 2:26413453-26413475 ACATTCCCACCCATGGAATGTGG + Intronic
928634316 2:33227603-33227625 TAATTCCAACACAGAGTAAGAGG - Intronic
929327383 2:40633029-40633051 TCATTCCATAAAAAAGAATGGGG - Intergenic
930472810 2:51841673-51841695 TCACTCCAACACAGACAATATGG + Intergenic
931596837 2:63956176-63956198 TCATCACAAAACATACAATGTGG + Intronic
932663396 2:73677185-73677207 TCATTCCAACTCATTTTATGAGG - Intergenic
932934270 2:76083630-76083652 TCACTCCAACCCAAAGAATAAGG - Intergenic
933016453 2:77133751-77133773 TCATAGCAACACATACAGTGAGG - Intronic
933223769 2:79721496-79721518 TGTTTCCAACACATGAAATGTGG + Intronic
933435796 2:82248092-82248114 TGCTTCTAACAAATAGAATGTGG - Intergenic
933678987 2:85082090-85082112 TGATTCTAACAAATAGAATATGG - Intergenic
933833219 2:86226876-86226898 TGCTTCCAACAAATAGAATAAGG + Intronic
934563860 2:95327773-95327795 TCCGTCCAACACACAGCATGAGG + Intronic
936078828 2:109418568-109418590 TCCTTACAACACAGAGAAGGAGG - Intronic
939425528 2:142031746-142031768 GCATTTCAACACATAAAATCAGG - Intronic
939529409 2:143338499-143338521 TCTCTCCAACAAATAGAATCAGG + Intronic
939530857 2:143359899-143359921 TCATTCCCAAACCTAAAATGAGG + Intronic
940044736 2:149397469-149397491 TTCTTCCACCTCATAGAATGTGG - Intronic
940588994 2:155696824-155696846 ACATTCCAACACAAAGAACAGGG + Intergenic
940972828 2:159912105-159912127 TCATTCTAACTGATAGAATCAGG - Intergenic
941278101 2:163516382-163516404 TAAGTCCAACACTTAAAATGCGG + Intergenic
941501500 2:166284278-166284300 TGCCTACAACACATAGAATGAGG + Intronic
941653281 2:168116653-168116675 TCATTCAATCACAGGGAATGTGG - Intronic
942747959 2:179257154-179257176 TCATTCTATGTCATAGAATGAGG + Intronic
942841217 2:180363811-180363833 TCTTTACAAAACATAGAATCAGG + Intergenic
943286555 2:186008506-186008528 TCATTCCATCACCTAGACTGGGG - Intergenic
943584627 2:189723521-189723543 TCATTCCAAGAAAAAAAATGAGG - Intronic
944618917 2:201491579-201491601 TCATTTCAATACAGAGACTGGGG - Exonic
945068730 2:205969962-205969984 TTATTTGAACAAATAGAATGAGG + Intergenic
945616190 2:212070600-212070622 TTCTTCCAACAAATAGTATGGGG + Intronic
945766491 2:213985963-213985985 TCATTCCTTCATATAGAAAGAGG - Intronic
947136137 2:226978596-226978618 TCATCCCCAGGCATAGAATGTGG + Intronic
1170297267 20:14841560-14841582 TCATTCAAATACATTGTATGTGG - Intronic
1172317540 20:33967875-33967897 TCACTTCCCCACATAGAATGTGG + Intergenic
1174198266 20:48788680-48788702 TGTTTCCAACACATGAAATGTGG - Intronic
1174450499 20:50617134-50617156 TCATTCCAAAACAAAGAAGGTGG + Intronic
1176011553 20:62899429-62899451 TCATTCCAACACTTACGATCTGG - Intronic
1178629551 21:34247402-34247424 TGCTTCTAACACATGGAATGGGG + Intergenic
1182043000 22:27252945-27252967 TCTGTCCACCACATAGATTGTGG + Intergenic
1182632752 22:31699971-31699993 TCATTCCAATATACAGAAAGGGG - Intronic
1182724671 22:32434789-32434811 TAATTAAAACATATAGAATGAGG + Intronic
1184289168 22:43489181-43489203 TCATCCCCACACACAGCATGTGG + Intronic
1185230993 22:49682289-49682311 ACTTTCCAACTCATTGAATGAGG - Intergenic
949642911 3:6059802-6059824 CCGTTCCAACACATAGATCGGGG - Intergenic
950499631 3:13355410-13355432 TCATTCCAAGACATGGGCTGTGG - Intronic
952604179 3:35124317-35124339 TCCTTCAAACAAATATAATGTGG - Intergenic
953590132 3:44243203-44243225 TCATTACAACCCTTGGAATGGGG - Exonic
953761483 3:45690606-45690628 TTTTTGCAACACATACAATGTGG - Intronic
954099820 3:48361829-48361851 TCATTCAAACTTATAAAATGTGG + Intergenic
954261954 3:49445705-49445727 TCATTCTATAAAATAGAATGAGG + Intergenic
955932886 3:64075648-64075670 TAATTACATCACAGAGAATGGGG + Intergenic
956139755 3:66133902-66133924 TCATTCCATCTTATAGAACGAGG - Exonic
956874213 3:73446104-73446126 TCATTCCAAAAAATAAATTGTGG - Intronic
957238974 3:77633357-77633379 TCATTCCACAAAAAAGAATGTGG + Intronic
957860205 3:85938503-85938525 TAATAGCAACACATATAATGGGG + Intronic
962152786 3:132910708-132910730 TCATGCCAATACATATAGTGTGG - Intergenic
962278146 3:134030719-134030741 TCATTCCAGCACTGAGAAGGAGG - Intronic
965180808 3:165400886-165400908 CCATTCCAACACATAAAACTGGG - Intergenic
965707681 3:171525599-171525621 GCATTGCAACACATATAATCAGG + Intergenic
966294672 3:178405726-178405748 ACAGGCCAACACATAGAATAAGG + Intergenic
966916457 3:184586935-184586957 TCATTCCAACTCAGAGGATGAGG + Intronic
968354079 3:198088127-198088149 TCATTCCAGTACATTAAATGGGG - Intergenic
974146292 4:57952169-57952191 TCATTCCTAGACCTAGAAAGTGG - Intergenic
974954119 4:68617579-68617601 TCATTCAAACACAAATTATGAGG + Intronic
974963652 4:68734199-68734221 TCTTTCCATTACAGAGAATGGGG + Intergenic
976264466 4:83177314-83177336 TCATTCTATGGCATAGAATGAGG + Intergenic
977731497 4:100358659-100358681 TTATTCCAAAAGACAGAATGGGG - Intergenic
977818734 4:101446625-101446647 TCATTCCCACACAAAGACTTTGG - Intronic
979282175 4:118880447-118880469 TCATTTCAAATCATAGAAGGTGG + Intronic
980502595 4:133675368-133675390 TCCTTCCAACAAATTGAAGGTGG + Intergenic
980648537 4:135678673-135678695 TCGTTCAAAAACATAGAATATGG + Intergenic
982810655 4:159821824-159821846 TTATTCTACCACAAAGAATGAGG - Intergenic
984779753 4:183514423-183514445 TCACTCCAACATCTAAAATGGGG + Intergenic
988125160 5:27023203-27023225 TAATTCCACCACATACAATTTGG + Intronic
988407982 5:30849275-30849297 TCATTCCAATATATAGAGTAGGG + Intergenic
988972837 5:36487108-36487130 TCATTCCAAATCTTAAAATGAGG - Intergenic
993232978 5:85263278-85263300 TAATTACAACATATAGATTGTGG + Intergenic
995382728 5:111552561-111552583 TATATCCAACACATAGAAAGAGG - Intergenic
996214771 5:120853215-120853237 TCATTCGAACACCTAAACTGTGG - Intergenic
996715922 5:126587987-126588009 ACCTCCCAACAAATAGAATGGGG - Intronic
997063102 5:130530236-130530258 ACATACCAACACATATACTGGGG - Intergenic
998185862 5:139979535-139979557 TGCTGCTAACACATAGAATGTGG + Intronic
1006918862 6:37614563-37614585 TCATTCCCCCACATAGAAGGAGG - Intergenic
1007484178 6:42169219-42169241 TGATTCTAACCCATAGAATATGG + Intronic
1008787888 6:55192215-55192237 TCATTCCAACAAAAAAAATTAGG + Intronic
1010024061 6:71195423-71195445 TCATGTCAAGACATAGAATGTGG - Intergenic
1010635431 6:78253759-78253781 TCATTCCAAGACAGAAAAGGCGG - Intergenic
1011596071 6:89017741-89017763 TAATCGCAACACAGAGAATGGGG - Intergenic
1013068703 6:106708663-106708685 TCAAGCCAACACAGAGGATGAGG - Intergenic
1014768989 6:125439803-125439825 TCATTCCAAAATATATACTGTGG + Intergenic
1015790940 6:136963986-136964008 AAATTCCAAGACATAGAATCTGG + Intergenic
1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG + Intronic
1020719182 7:11720084-11720106 ACATTCCAACACATTGACAGGGG + Intronic
1021542831 7:21779112-21779134 TAATTCCAACATTTAGAGTGCGG + Intronic
1023408188 7:39858911-39858933 TCATTCCAACTCAGAGAATCTGG + Intergenic
1025137673 7:56433620-56433642 TCATTCCAACTCAGAGAATCTGG - Intergenic
1026317624 7:69240817-69240839 TGATTCCAAGACATCGGATGTGG + Intergenic
1028723140 7:94057186-94057208 TGATTTCAACAAATAGAATATGG - Intergenic
1030739790 7:113095107-113095129 TAATTTCAGCACATAGAATTTGG + Intergenic
1031564173 7:123274311-123274333 TGATTTCAAAACCTAGAATGTGG - Intergenic
1032297527 7:130654021-130654043 TCATTAAAACACAAAAAATGGGG + Intronic
1033863350 7:145658434-145658456 TCCTGGGAACACATAGAATGAGG + Intergenic
1036383059 8:8251717-8251739 ACATTCCCACACAAAGAATAAGG - Intergenic
1038680079 8:29658660-29658682 TCAATTCAGCACATAGAAAGTGG - Intergenic
1038945059 8:32350021-32350043 ACATTCCAACACAGAGAAATAGG + Intronic
1039805971 8:40998705-40998727 TCTTTCCAACTCATTTAATGAGG - Intergenic
1040800990 8:51339575-51339597 TTATTCCAACGCATACAATAAGG + Intronic
1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG + Intergenic
1043654952 8:82651566-82651588 TGTTTCCAACACATAAAATTTGG + Intergenic
1043707763 8:83374464-83374486 TCATCCCAACAAATAAAATTTGG - Intergenic
1044080554 8:87877121-87877143 TCATTCCAAAAAATAGATTTTGG + Intergenic
1045047174 8:98290515-98290537 TTATTCAACCACATAGCATGAGG + Intronic
1045110194 8:98933073-98933095 TAACTCCAACACATAGAATGGGG + Intronic
1045831594 8:106468149-106468171 TCTCTCCAAGACCTAGAATGGGG - Intronic
1045846365 8:106641795-106641817 TCAGGCCAAAACATAGAGTGAGG + Intronic
1045862494 8:106828853-106828875 TCCTCCTAACAAATAGAATGTGG - Intergenic
1048100392 8:131344364-131344386 TCATTAGAGCATATAGAATGTGG - Intergenic
1051605377 9:18913042-18913064 TTCTTCCAACACATAGAACTTGG - Intergenic
1053055529 9:34991278-34991300 TCATTCCAACACGTGGCCTGTGG + Intronic
1055741794 9:79397531-79397553 ACATTCAAACACATAGCAAGAGG - Intergenic
1056524206 9:87427724-87427746 CCGTTCCATCACATAGACTGTGG + Intergenic
1059321396 9:113473166-113473188 TGCTTCTAACAAATAGAATGTGG - Intronic
1060241551 9:121908096-121908118 GCATTCAAACATAAAGAATGTGG + Intronic
1186400235 X:9251332-9251354 CCATCCCAACAAGTAGAATGTGG - Intergenic
1186406673 X:9310446-9310468 TGCTTCCAACAAATAGAATAAGG + Intergenic
1187017181 X:15341329-15341351 TCACTCCACCACAGGGAATGTGG + Intergenic
1187673672 X:21693786-21693808 TCATTCCCAGACATAGAAAAAGG + Intergenic
1189178222 X:38979277-38979299 TCATTCCAACTCTTACAGTGAGG - Intergenic
1191899766 X:66028741-66028763 TCACTCCAGCACCTGGAATGGGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1194002090 X:88443145-88443167 TCTTTTCAACAGAAAGAATGGGG - Intergenic
1195114462 X:101682934-101682956 TCATTCCACCACATAGAAATGGG + Intergenic
1195465105 X:105171582-105171604 ACCTTCCATCATATAGAATGTGG + Intronic
1196138752 X:112237802-112237824 TCATTCATTCACAAAGAATGTGG - Intergenic
1196492220 X:116281118-116281140 ACATTCAAACACAGAGAATTAGG - Intergenic
1196896289 X:120340029-120340051 AGTTTCCAACACATAAAATGTGG - Intergenic