ID: 1016672285

View in Genome Browser
Species Human (GRCh38)
Location 6:146722818-146722840
Sequence CCATTAGAACAGAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016672285_1016672289 4 Left 1016672285 6:146722818-146722840 CCACCTTCCTTCTGTTCTAATGG 0: 1
1: 0
2: 1
3: 28
4: 314
Right 1016672289 6:146722845-146722867 ACAATCTCTGCTCCTCTACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016672285 Original CRISPR CCATTAGAACAGAAGGAAGG TGG (reversed) Intronic
901147638 1:7077385-7077407 CCATTAGAACTGCAGCAACGGGG - Intronic
902107919 1:14053036-14053058 CCAGTAGAACACAGCGAAGGTGG + Intergenic
903336854 1:22630230-22630252 ACATTTGAACACCAGGAAGGAGG - Intergenic
904064542 1:27738964-27738986 TGATTAGAACAGAAAGAAGATGG + Intronic
904506919 1:30964697-30964719 CCATGTGAAGAGAGGGAAGGAGG + Exonic
905025929 1:34849431-34849453 ACATTAGAACAGGAGGGAGCAGG + Intronic
905827394 1:41036302-41036324 ACCATAGAAGAGAAGGAAGGTGG - Intronic
905931855 1:41793474-41793496 CTATTAGAACAGGTGGGAGGAGG + Intronic
907777907 1:57536820-57536842 CCATGGGAACAGAAGCATGGAGG - Intronic
909069212 1:70974235-70974257 CGATTAGAACAGAGAGACGGGGG + Intronic
909206037 1:72759045-72759067 CCATTTCAAAAGAGGGAAGGAGG + Intergenic
909274818 1:73669591-73669613 CCATAAGAACTGAAAGAAGAGGG + Intergenic
909973402 1:82018182-82018204 CAAAGAGAAAAGAAGGAAGGTGG - Intergenic
911829796 1:102536386-102536408 TCATGAGAACAGAGGGAAGGGGG + Intergenic
911955959 1:104235460-104235482 ACATGAGAAGAGAATGAAGGAGG - Intergenic
912392706 1:109315551-109315573 CCCTTAGAACAGCAGAGAGGAGG + Intronic
913513094 1:119580479-119580501 CCATAGGAACCAAAGGAAGGTGG + Intergenic
914954490 1:152148428-152148450 CCTGTAGTACAGAAGGAAAGAGG - Intergenic
917647720 1:177045463-177045485 CCAGCAGAAAAGAAGGAAGAGGG - Intronic
918037839 1:180893095-180893117 CCTTGAAAAAAGAAGGAAGGGGG + Intergenic
919153742 1:193733631-193733653 AAATTCGAACATAAGGAAGGTGG + Intergenic
919345804 1:196376725-196376747 CAATTAAAAAAGAAAGAAGGAGG + Intronic
920152042 1:203918484-203918506 CCATGAAAACATAATGAAGGTGG - Intergenic
920943312 1:210504652-210504674 CCATCAGATCATCAGGAAGGAGG - Intronic
921593259 1:217027699-217027721 CCCACAGATCAGAAGGAAGGTGG + Intronic
921751982 1:218805593-218805615 AAATTAGAACAGAAGGACTGAGG - Intergenic
922039001 1:221877310-221877332 CCATTAGGAAAGAAGAGAGGAGG + Intergenic
922736889 1:227990241-227990263 CCATATCAACAGAATGAAGGGGG + Intergenic
923523430 1:234753968-234753990 CAATTAGATCATAAGGGAGGAGG + Intergenic
923558069 1:235017346-235017368 CCAGGAGAACAGATGGAAAGAGG + Intergenic
1063122340 10:3113789-3113811 ACATTAGGTGAGAAGGAAGGTGG + Intronic
1064085959 10:12347022-12347044 CCATTAGAAAAAAAGAAAGAAGG - Intergenic
1064490208 10:15847892-15847914 GCATTAGAACAGTTTGAAGGTGG - Exonic
1065198496 10:23290118-23290140 CCATCTGAACAGCAGGAAGAAGG - Intronic
1065318001 10:24483363-24483385 CAATGAGAACAGGCGGAAGGTGG - Intronic
1068996537 10:63212129-63212151 CCATAGAAACAGAAGAAAGGTGG + Intronic
1069077309 10:64051946-64051968 CCATGAAAGCAGCAGGAAGGGGG - Intergenic
1069509540 10:69031484-69031506 GCATTAGGACAGCAGCAAGGAGG - Intergenic
1070901296 10:80031191-80031213 CCAAAAGAAGAGAAGGAAGGGGG + Intergenic
1071141131 10:82510590-82510612 CCATTAGAACGGAAGGAACAAGG + Intronic
1072294040 10:93993143-93993165 CCATTAGAACAGGTAGAGGGAGG + Intergenic
1074700252 10:116086291-116086313 CCTTTACAACAGATGGAAGGTGG - Intronic
1075254948 10:120918327-120918349 CCACTTTAAAAGAAGGAAGGAGG + Intergenic
1075490775 10:122867206-122867228 GCATAAGAACAGATTGAAGGTGG + Intronic
1075618994 10:123911975-123911997 GCTTTAGAACAGAAAGGAGGGGG + Intronic
1076681234 10:132172510-132172532 CCAATGAAATAGAAGGAAGGGGG - Intronic
1078811191 11:14765644-14765666 ATATTAGCACAGAAGGAAAGAGG + Intronic
1079610478 11:22426910-22426932 CCATTAGAAGAGCAGAAAGTAGG + Intergenic
1079935874 11:26615319-26615341 ACATGAGAACAGAAGGAATAGGG - Intronic
1081435726 11:43025612-43025634 CCATGAGAATAAAAGAAAGGAGG + Intergenic
1082059850 11:47850474-47850496 CCATCTGGAAAGAAGGAAGGAGG + Intergenic
1083433309 11:62626204-62626226 ATAACAGAACAGAAGGAAGGAGG + Intronic
1084309902 11:68311012-68311034 CCATGAGATCAGGTGGAAGGGGG + Intergenic
1084369652 11:68732203-68732225 GCATTGGAACAGAGGAAAGGAGG - Intronic
1085494079 11:76951612-76951634 GCAGAAGAATAGAAGGAAGGGGG - Intronic
1087117834 11:94543938-94543960 GCCCTAGAACAGACGGAAGGCGG - Exonic
1088477805 11:110261801-110261823 CTATTTAAAAAGAAGGAAGGTGG - Intronic
1088726204 11:112637329-112637351 GCTTCAGAACTGAAGGAAGGAGG - Intergenic
1089701150 11:120244780-120244802 CCATTGGAACAGAAGGCCAGTGG + Intronic
1089798789 11:121006315-121006337 TCATAAGAACAGAAGCATGGGGG - Intergenic
1089982631 11:122785032-122785054 CCTTTCTAAGAGAAGGAAGGTGG + Intronic
1090887781 11:130894379-130894401 GCATTAGAGCAGAAGGAAGAAGG + Intronic
1093069245 12:14691431-14691453 CCAGGAGAACAGAATGAATGAGG + Intronic
1093396800 12:18693036-18693058 CCATTAGAAGAAAAGCAAGAAGG + Intronic
1094237504 12:28185610-28185632 CCAGTAGATTAAAAGGAAGGAGG + Intronic
1096254875 12:50056854-50056876 GAATTTGGACAGAAGGAAGGAGG - Intergenic
1096969211 12:55651955-55651977 CCATTAAAACAGCTGGGAGGGGG + Intergenic
1097287115 12:57886911-57886933 GCATTAGAAGACAAGGAAGGAGG + Intergenic
1097606274 12:61758475-61758497 CCATTTTAACAAGAGGAAGGTGG + Intronic
1098377247 12:69830020-69830042 TTATTAGGACAGAAGGAAGAGGG - Intronic
1098519002 12:71414290-71414312 CCATTATCTCAGAAGTAAGGTGG - Intronic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1099370989 12:81829644-81829666 GCCTTAGAGCAGAAGAAAGGAGG - Intergenic
1099386173 12:82016752-82016774 CCATGAGAACAGCAGTATGGGGG + Intergenic
1099726323 12:86432502-86432524 CAAGTAGAAGAGATGGAAGGTGG + Intronic
1100601340 12:96113961-96113983 CCATTAGAGGAGCAGGAAAGTGG - Intergenic
1101250434 12:102928985-102929007 CCATGAGAACAGCAGCATGGGGG - Intronic
1101707354 12:107232907-107232929 GCGTGAGAACAGAAGGAGGGTGG - Intergenic
1104245481 12:127036201-127036223 TCAGTGGAACAGAAGGAAGATGG + Intergenic
1104606471 12:130193176-130193198 GCATTACACCAGCAGGAAGGGGG + Intergenic
1105288818 13:19032536-19032558 CCTTTAGAACTGAAGGACAGAGG - Intergenic
1105663041 13:22520618-22520640 GCAATATAACAGAAGGCAGGAGG + Intergenic
1106364573 13:29066047-29066069 CCCTTAGGACAGAAAGAGGGTGG - Intronic
1106835594 13:33631257-33631279 CCATTTCTTCAGAAGGAAGGAGG - Intergenic
1108737004 13:53294675-53294697 CCAATAGAAGAGAAGGGAGAGGG + Intergenic
1111619807 13:90709893-90709915 CTAATATAACACAAGGAAGGGGG + Intergenic
1113815187 13:113164702-113164724 CCAGTACTACAGAAGGAAGGAGG - Intronic
1114839380 14:26245590-26245612 GAATGAGAACTGAAGGAAGGCGG + Intergenic
1115006504 14:28491943-28491965 CCATTCCAACAGGAGGAAGTAGG + Intergenic
1117578234 14:57123338-57123360 CCATTGTAACAGTATGAAGGTGG - Intergenic
1118293895 14:64550661-64550683 TCAGTAGAACGGCAGGAAGGAGG - Intronic
1118377852 14:65192426-65192448 CCATGAGAAAAGAAGGAAAATGG - Intergenic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1121150562 14:91629848-91629870 CCTTTAAAAGAGAAGGAAAGGGG + Intronic
1121467347 14:94124533-94124555 CTTCTAGAAGAGAAGGAAGGTGG + Intergenic
1124424685 15:29554012-29554034 CCATTTAAAAGGAAGGAAGGGGG + Intronic
1124867032 15:33502448-33502470 CCATGAGAACAACAGGAATGAGG - Intronic
1125324606 15:38524283-38524305 CCATCAGCACAGAAGAATGGTGG + Intronic
1126133671 15:45369475-45369497 CCATTTTACCAGAAGCAAGGAGG - Exonic
1126471104 15:49011698-49011720 CCATGAGAAGAGGAGAAAGGGGG + Intronic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1128137641 15:65275811-65275833 GGAATAGAAAAGAAGGAAGGGGG - Intronic
1128379048 15:67098305-67098327 AGATTAAAAAAGAAGGAAGGAGG + Intronic
1128912053 15:71524531-71524553 CCATGAGCACAGGAGGAAGATGG + Intronic
1129142358 15:73611580-73611602 CCAGGAGATAAGAAGGAAGGAGG + Intronic
1131414371 15:92240522-92240544 CCATTCTTACAGAAGTAAGGTGG - Intergenic
1131623812 15:94096755-94096777 CCATTAGAATATAAGCATGGTGG - Intergenic
1133304640 16:4801585-4801607 CCTGTGGAACAGAGGGAAGGAGG + Exonic
1133716961 16:8459009-8459031 AAAAAAGAACAGAAGGAAGGCGG - Intergenic
1134155936 16:11843480-11843502 CCTTTAGAACAGCTTGAAGGCGG - Intronic
1134391482 16:13824072-13824094 CCATGAGAACAGCAGCATGGGGG - Intergenic
1134743189 16:16566535-16566557 CCATCAGAACAAGAGGAAGAAGG - Intergenic
1134924371 16:18145925-18145947 CCATCAGAACAAGAGGAAGAAGG + Intergenic
1135709358 16:24701826-24701848 CCATAAGACCAGAAGGAAGGAGG - Intergenic
1137512387 16:49113056-49113078 CCATGAGATGAGAAGGAAGGCGG - Intergenic
1138479063 16:57289843-57289865 CCATTTGAAAAGAATGAAAGTGG - Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1142134740 16:88446469-88446491 CCATGAGATGAGATGGAAGGAGG - Intergenic
1142253125 16:89001922-89001944 CCCTTAGAAGAGAAGGAGGATGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146176061 17:30667412-30667434 CCATTAGCACGCAGGGAAGGGGG + Intergenic
1146349519 17:32083522-32083544 CCATTAGCACGCAGGGAAGGGGG + Intergenic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1150009678 17:61492269-61492291 CCATAAGAGGGGAAGGAAGGAGG - Intergenic
1151194868 17:72424251-72424273 TCATCAGAACAGGAGGAAGGGGG + Intergenic
1151195337 17:72427250-72427272 GCATCAGAACAGGAGGAAGGGGG + Intergenic
1152260823 17:79266117-79266139 CCATTGGAATCAAAGGAAGGAGG - Intronic
1152673088 17:81620704-81620726 GCAACAGAAGAGAAGGAAGGAGG + Intronic
1153778448 18:8473983-8474005 CAATAAGGACAGAAGGAAGTGGG - Intergenic
1154973601 18:21435392-21435414 CCACTAGATCACAAGGAAGTTGG - Intronic
1155132665 18:22953999-22954021 CCACAAGAACAGAAGCATGGGGG + Intronic
1155593230 18:27452516-27452538 ACATTAGAAGAAAAGGAAGCTGG - Intergenic
1156385620 18:36602285-36602307 CCATCAGCACAGAAGAAAAGGGG - Intronic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1157984923 18:52426225-52426247 CAATGAGAACATAATGAAGGTGG + Intronic
1158183287 18:54742428-54742450 CTATCAGAACGGAAGGCAGGAGG + Intronic
1158506328 18:58049255-58049277 GCATTAGCACAGAAGGAACTGGG + Intronic
1160524632 18:79527795-79527817 TCATGACAACAGAAGGGAGGTGG + Intronic
1162982763 19:14249490-14249512 CCATTAGCACGCAGGGAAGGGGG - Intergenic
1164818495 19:31225622-31225644 CCTTTGTAACTGAAGGAAGGTGG - Intergenic
1165073887 19:33270170-33270192 CCATTAGCACAGAGAGGAGGCGG + Intergenic
1165677160 19:37736512-37736534 AGATCAGATCAGAAGGAAGGAGG + Intronic
1166505424 19:43368671-43368693 CCATCAGAACAGATGTAAGGTGG - Intergenic
1167233408 19:48298894-48298916 CCATCACGACAGCAGGAAGGAGG + Intronic
1167819749 19:51916805-51916827 CCAGTTGAACAGAAGTAGGGGGG - Intronic
1168012309 19:53543119-53543141 CCATTAGAAAAAAAAGGAGGGGG + Intronic
925516902 2:4692805-4692827 CCATCAGTACAGAAGGAGGGTGG - Intergenic
925620636 2:5789227-5789249 ACATGAGTGCAGAAGGAAGGAGG + Intergenic
926950506 2:18237588-18237610 GCATTACAACTGAAAGAAGGGGG - Intronic
928254902 2:29713658-29713680 CCATTAGAAAAGAATGAACCTGG - Intronic
929342222 2:40834303-40834325 CCTTTAGGAAGGAAGGAAGGAGG - Intergenic
931428348 2:62191039-62191061 GTATTATAACAGGAGGAAGGAGG - Intergenic
932321085 2:70822474-70822496 GCATTAGAAGAGAAGGCATGAGG + Intergenic
932973329 2:76572565-76572587 CCATTAAAACACCTGGAAGGTGG - Intergenic
933236686 2:79871984-79872006 ACAGTAGAACAGAAGGAAAGGGG + Intronic
933256143 2:80083066-80083088 ACATGAGAACAGAAGGAGGGAGG - Intronic
935456190 2:103270136-103270158 ACAATAGAAAAGGAGGAAGGTGG - Intergenic
935519355 2:104084940-104084962 CCAGTAAAACAGAAAGAAAGGGG - Intergenic
939333383 2:140792148-140792170 CCATTTTAACAAAGGGAAGGGGG - Intronic
939828236 2:147041241-147041263 TCAGGAGAAGAGAAGGAAGGGGG + Intergenic
940626308 2:156179747-156179769 CAAGTAAAAGAGAAGGAAGGTGG + Intergenic
941116941 2:161482467-161482489 CAATTAGAGAAGAAGTAAGGAGG + Intronic
941469888 2:165871369-165871391 AAATTAGAAGGGAAGGAAGGAGG + Intronic
941947617 2:171117100-171117122 CCATGAAAAAAGAGGGAAGGTGG + Intronic
942570967 2:177313850-177313872 CCATTAGAAGAGCTGGAAGAAGG - Intronic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
945092170 2:206185877-206185899 CCATGAGAAGAGGAGGAAAGGGG - Intronic
945555698 2:211272663-211272685 CAATTGGAATATAAGGAAGGAGG - Intergenic
945717040 2:213370060-213370082 ATATTAGAAAAGTAGGAAGGAGG - Intronic
946472402 2:219974434-219974456 CCATGAGAACAGCAGCATGGGGG + Intergenic
947014758 2:225606946-225606968 ACAATAGAACAGAAGAAGGGTGG - Intronic
947924555 2:233909830-233909852 CCCCTAGATCAGAAGGAAGATGG + Intergenic
948733446 2:239982020-239982042 CTATTAGAGCAGAAGGTAGTTGG - Intronic
1169309870 20:4526914-4526936 TCAATAGAATAGAAGGAGGGAGG + Intergenic
1169894077 20:10483787-10483809 CCTTTAGAAGAGAAGGGTGGGGG - Intronic
1169956069 20:11104406-11104428 CCATTAAAAAAGAAGGAAATTGG + Intergenic
1170057398 20:12221751-12221773 GCAATAGAACAGAAGCAAGCTGG - Intergenic
1171028285 20:21652860-21652882 CCATCAGAACTGAGAGAAGGAGG - Intergenic
1171564741 20:26171129-26171151 CCATGAGAAAAGAAGGGAAGTGG + Intergenic
1173393155 20:42653134-42653156 CCATGAGAACAGCAGCATGGGGG - Intronic
1173491790 20:43488644-43488666 TCATTTGAACCGAAGGACGGAGG - Intergenic
1174056831 20:47803890-47803912 CCATTAGAATAGAATCCAGGTGG - Intergenic
1175443978 20:59007738-59007760 CCTTTTGCAGAGAAGGAAGGAGG + Intergenic
1175597959 20:60250471-60250493 TCATTAAAACTGGAGGAAGGTGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177716667 21:24847370-24847392 CCATTCGTACAGGAGTAAGGTGG + Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1177835120 21:26179254-26179276 CCATTAAGAAAGAAGAAAGGAGG + Intergenic
1178167681 21:29999319-29999341 ACATTAGAAAGGAGGGAAGGAGG - Intergenic
1178918694 21:36724037-36724059 CTCTTAGAAAAGAAGGGAGGAGG + Intronic
1178930194 21:36811521-36811543 GCATTAGAACAGCAGCAGGGAGG - Intronic
1184814985 22:46862445-46862467 CCCTGAGAACAGAAGCAAGAGGG - Intronic
1185338225 22:50280241-50280263 TCTGCAGAACAGAAGGAAGGTGG - Intronic
1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG + Intronic
949351708 3:3129932-3129954 CCATGAGAACTGAAGGAAGAAGG + Intronic
950593465 3:13956614-13956636 CCATTCTAACAGGAGTAAGGTGG + Intronic
950624818 3:14237425-14237447 CCATTATAATAGAAGGAGGGTGG + Intergenic
952026506 3:29088798-29088820 CCATTCGAGGAGAAGGAAGGAGG - Intergenic
952996255 3:38885407-38885429 ACATCAGAACAAAACGAAGGGGG + Intronic
953127588 3:40106600-40106622 AAATAAGAACAGAAGGAAAGTGG - Intronic
953365151 3:42337875-42337897 CCATTTGAAAGGAAAGAAGGTGG - Intergenic
955119904 3:56047575-56047597 CCCTGAGAACAAAATGAAGGAGG + Intronic
956253847 3:67263215-67263237 CCAGCAGCACAGAGGGAAGGGGG + Intergenic
956684205 3:71809365-71809387 CCATGAAAATAGAAAGAAGGAGG + Intergenic
956731690 3:72202229-72202251 GCATTAGAACAGAGGAAATGAGG - Intergenic
960239320 3:115321982-115322004 CAATTAGAAAAGAAGGAAAATGG + Intergenic
960366874 3:116783402-116783424 CCATGAGAAAAGGAGGAAGATGG - Intronic
961131795 3:124475320-124475342 CCATGATAACAGCATGAAGGAGG - Intronic
961229574 3:125291516-125291538 CCAGTAGAGTAAAAGGAAGGTGG + Intronic
961709730 3:128818906-128818928 CCAATGGAAAAGAAGGAAGTGGG - Intergenic
962947513 3:140185352-140185374 CCAATAGAAAAAAAGAAAGGTGG - Intronic
963197264 3:142546129-142546151 CCACTAGAACAGAGGGTAGGAGG + Intronic
963508213 3:146214421-146214443 CCATTAAAAAAAAAGGAAGAGGG - Intronic
963562690 3:146886078-146886100 CCATTAGAACGGATTGAAGGAGG + Intergenic
964922553 3:161914929-161914951 CCATTACCACAGAATGAAGATGG + Intergenic
966226398 3:177602802-177602824 CGATAAGAAAAGGAGGAAGGAGG + Intergenic
966667019 3:182482668-182482690 CCATCAGAAAAGGAGGGAGGAGG - Intergenic
967941887 3:194772552-194772574 CACTTAGAACACAAGGAAGTTGG + Intergenic
967979402 3:195056610-195056632 CCATTTGCACAGCAGGAAGCAGG + Intergenic
970713650 4:18894472-18894494 CCTTTATAAAAGAAGGCAGGGGG + Intergenic
970817423 4:20173987-20174009 CTACTAGAAAAGAAAGAAGGAGG + Intergenic
971986410 4:33830435-33830457 CCATGAGAAAAGAAGGGAAGTGG - Intergenic
972906907 4:43761162-43761184 CCATTTGAATAGAAAGTAGGGGG - Intergenic
973796977 4:54437415-54437437 CCACTGAAATAGAAGGAAGGAGG - Intergenic
973886141 4:55324115-55324137 CTAATAGAACAGAAGGACAGAGG + Intergenic
974913650 4:68152833-68152855 CCATTATGACAGTAAGAAGGGGG + Intergenic
975415170 4:74097741-74097763 CCAACTGACCAGAAGGAAGGAGG - Exonic
975916353 4:79330448-79330470 CCATTGAAACAGAAGAAAAGAGG + Intergenic
976024154 4:80666537-80666559 ACATAAGATGAGAAGGAAGGTGG - Intronic
977572607 4:98645207-98645229 CCATTATAACAAAAGAAAAGAGG + Intronic
980236334 4:130111845-130111867 CTATTAGAAAAGAATGAAAGAGG - Intergenic
980672515 4:136027732-136027754 CCATTCTTACAGAAGTAAGGTGG - Intergenic
980969779 4:139557136-139557158 CCATTACCACAGCAGCAAGGAGG - Intronic
982077455 4:151751909-151751931 CCGTTGGAAGAGGAGGAAGGTGG - Intronic
982806992 4:159778652-159778674 CAATTAAAACAGATGGAATGTGG - Intergenic
983317301 4:166148724-166148746 TCATGAGAACAGAAGCATGGGGG - Intergenic
984433358 4:179677214-179677236 TCATGAGAACTGAAGGCAGGAGG - Intergenic
986262534 5:6160769-6160791 CTTTTAAAACAGAAGGAAAGTGG + Intergenic
986500442 5:8393203-8393225 GCTTTTGAAAAGAAGGAAGGAGG + Intergenic
987199690 5:15563597-15563619 CCAGGAGCAGAGAAGGAAGGAGG - Intronic
987586978 5:19867913-19867935 TCACTAGAACAGAAGCATGGGGG - Intronic
988822957 5:34905823-34905845 CAATTAGAACACAAATAAGGAGG + Exonic
988933986 5:36064855-36064877 TCACTGGAACAGAAGGAATGAGG + Intronic
989406380 5:41065690-41065712 CCAAAAGAACAGAAGGTGGGAGG - Intronic
989987251 5:50715266-50715288 ACAGTAGAACAGTAGGCAGGAGG + Intronic
990229630 5:53698551-53698573 CCCTTAGAACAGAACATAGGGGG + Intergenic
991415775 5:66391503-66391525 CCATTCTTGCAGAAGGAAGGTGG - Intergenic
992875552 5:81050927-81050949 CCATTAGGGCAGAAGAAAGCTGG + Intronic
994464520 5:100109674-100109696 TCATAAGAACAGCAGCAAGGAGG - Intergenic
994689657 5:103000796-103000818 TCATGAGAACAGCAGAAAGGGGG + Intronic
994998760 5:107100583-107100605 CCTTTAGAACAGAAGAAATTGGG - Intergenic
997114633 5:131112774-131112796 CCACTGGAACAGAAGGAAAAAGG + Intergenic
997642159 5:135456358-135456380 CGATTACAACAGAAGGCAGTGGG - Intergenic
997776840 5:136616786-136616808 CTGTTAGAACACAAGTAAGGTGG - Intergenic
998209371 5:140182790-140182812 CTATGAAAACAGAAGAAAGGGGG + Intronic
999177136 5:149639568-149639590 GCATTAGAACAGAAGGAATTTGG - Intergenic
999655013 5:153802654-153802676 CCATGAGAAAGGAAGGAAGATGG + Intronic
999675936 5:154002902-154002924 CCATTAGCAGAGAATGAAGAAGG - Exonic
1001148003 5:169201729-169201751 CCAGGGGAAGAGAAGGAAGGAGG + Intronic
1001702861 5:173720394-173720416 CCTTTAAAACAGAAGGCAAGAGG - Intergenic
1002793935 6:455854-455876 GCATTAGAAAAGAATGAATGAGG - Intergenic
1004862880 6:19823529-19823551 ACAAAAGAACAGAAGGAAGGAGG - Intergenic
1006061749 6:31425899-31425921 CCACTATTACAGAAGTAAGGTGG + Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1008252903 6:49262705-49262727 CCATTTGAAAAGGAGGAAGCAGG - Intergenic
1008387318 6:50906727-50906749 CCATAAGAAAACAAGGAAAGGGG - Intergenic
1008654809 6:53601195-53601217 CCTTTAGAACAGATGGGAGAAGG + Intronic
1010294505 6:74180889-74180911 CCAATAGAACAGAACTGAGGAGG - Intergenic
1010373891 6:75143932-75143954 CCATTATAAAAGGGGGAAGGAGG + Intronic
1010759220 6:79702991-79703013 GCACCAGAACAGAAGGAGGGTGG + Exonic
1011011905 6:82712387-82712409 CCTGGAGAAAAGAAGGAAGGTGG + Intergenic
1011859725 6:91739585-91739607 CCAATAGAACAGAAAGATGGAGG + Intergenic
1014062342 6:117086199-117086221 CCAGAAGAAGAGAAGGAAGAGGG + Intergenic
1014926892 6:127282719-127282741 CCATTTGAACAGCAGGTTGGAGG - Intronic
1016143346 6:140640927-140640949 CCAATAGGAAAGTAGGAAGGTGG - Intergenic
1016672285 6:146722818-146722840 CCATTAGAACAGAAGGAAGGTGG - Intronic
1017523709 6:155224561-155224583 TCATTAGTATGGAAGGAAGGAGG + Intronic
1018407137 6:163498569-163498591 ACATAAGAACAAAAGGAAGAAGG - Intronic
1019805192 7:3118356-3118378 TCATGAGAACACAATGAAGGGGG - Intergenic
1021192465 7:17637420-17637442 CCATGAGAACAGCAGGAGGATGG + Intergenic
1023210505 7:37798941-37798963 CCAATAGAACACAAGGAAAGTGG + Intronic
1023990416 7:45125322-45125344 CCATGAGATCAGCAGAAAGGAGG - Intergenic
1024928371 7:54642172-54642194 CCAATAGAACAAAAGGAGTGAGG + Intergenic
1025911518 7:65832505-65832527 CCAGTGGAGCAGAAGGAAAGAGG + Intergenic
1026673932 7:72413944-72413966 TCATGGAAACAGAAGGAAGGGGG - Intronic
1027737470 7:81952020-81952042 CCATTAGTGCAGGAGTAAGGTGG + Intronic
1032380619 7:131476026-131476048 CCATGTTAACAGAATGAAGGAGG + Intronic
1033104822 7:138511635-138511657 CCATGAGAACAGCACCAAGGAGG + Intronic
1033477316 7:141702999-141703021 CTATTAAAATAGAAAGAAGGAGG + Intergenic
1033651970 7:143350671-143350693 CCATTTGAGCAGCAGGAGGGAGG + Intronic
1033722573 7:144077273-144077295 CCATTTTACCAGAAAGAAGGAGG + Intergenic
1034804264 7:154075107-154075129 CCATTTGTGCAGGAGGAAGGTGG - Intronic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1036059098 8:5294951-5294973 CCATAAGAATAGAGAGAAGGTGG + Intergenic
1037726752 8:21488781-21488803 CCATTAAAATAGAAATAAGGAGG + Intergenic
1038532765 8:28331767-28331789 CAATCAGAACATGAGGAAGGAGG - Intronic
1039454938 8:37699902-37699924 GCATCAGACCAGAAGGAGGGAGG - Exonic
1039742764 8:40397428-40397450 CAATTAGAACAGAGAGAGGGTGG + Intergenic
1039960605 8:42244344-42244366 CCTTTAGAAAATAAGGGAGGGGG + Intergenic
1040643157 8:49364756-49364778 ACATTGGAACAGAAGTAAGGTGG - Intergenic
1041590552 8:59576820-59576842 CCATTAGATTACAATGAAGGTGG + Intergenic
1047163142 8:122404469-122404491 CCACTAGAAAAGAAGAAAGTAGG - Intergenic
1047427774 8:124762191-124762213 CCAAAAGAAGACAAGGAAGGTGG - Intergenic
1049281390 8:141749005-141749027 CCATTACAGCAGAAGTTAGGAGG + Intergenic
1049521573 8:143094176-143094198 CCTTCAAAACAGGAGGAAGGAGG - Intergenic
1049907185 9:229003-229025 ACATTCTAAGAGAAGGAAGGTGG + Intronic
1050623027 9:7474417-7474439 CCAGCAAAACAGAAGGATGGGGG + Intergenic
1051544375 9:18257944-18257966 TCTTCAGAGCAGAAGGAAGGAGG + Intergenic
1052487163 9:29117205-29117227 CTATTAGAAGTGAAGGAAGCAGG + Intergenic
1056300447 9:85234752-85234774 CCATTGGAACAGTAGGAGGTTGG - Intergenic
1057313901 9:93957159-93957181 CCATTGGGACTGAAAGAAGGTGG + Intergenic
1057613210 9:96566053-96566075 CCATTAAAACAGAAGCAATGAGG + Intronic
1057939710 9:99271298-99271320 CCTCTGGATCAGAAGGAAGGGGG + Intergenic
1058297052 9:103322261-103322283 CCATTAGAAGACAGGAAAGGTGG + Intergenic
1059061495 9:111038555-111038577 CAAGCAGAAAAGAAGGAAGGCGG - Intergenic
1059506446 9:114803709-114803731 GCAAGAGCACAGAAGGAAGGAGG - Intronic
1059634558 9:116158147-116158169 CCATTAGAACAAAAGAAAAAAGG - Intronic
1060189364 9:121582341-121582363 GCATGGGGACAGAAGGAAGGGGG - Intronic
1060340574 9:122772191-122772213 CTATCATAAAAGAAGGAAGGAGG + Intergenic
1061136875 9:128739817-128739839 ACAGAAGACCAGAAGGAAGGTGG + Intronic
1061958215 9:133974557-133974579 CCATTTCCACAGTAGGAAGGTGG - Intronic
1203769338 EBV:40948-40970 CCATTAAAACGGAAGGAGGAAGG - Intergenic
1203789616 EBV:143867-143889 CCATTAAAACGGAAGGAGGAAGG - Intergenic
1185840313 X:3383445-3383467 CTATTTGCAGAGAAGGAAGGTGG - Intergenic
1186199634 X:7144022-7144044 CCATTACAAATGATGGAAGGAGG + Intronic
1187186593 X:16992563-16992585 CAATAAAAACATAAGGAAGGTGG - Intronic
1188586080 X:31777168-31777190 CCATTAGAATGGAAGAATGGAGG + Intronic
1189428699 X:40928570-40928592 ACATTGGAAAAGCAGGAAGGTGG + Intergenic
1189534737 X:41924008-41924030 CGATTACAAAAGAAGGAAAGGGG - Intergenic
1189686205 X:43565843-43565865 CCATAAGAAAAGAAACAAGGTGG + Intergenic
1189953376 X:46254922-46254944 CCAACAGTACAGAGGGAAGGGGG + Intergenic
1192221067 X:69197658-69197680 CTATTAAAAGAGAAGGAAGTGGG - Intergenic
1193281813 X:79659898-79659920 CCATTATTGCAGAAGTAAGGTGG + Intergenic
1193316484 X:80071563-80071585 CCATGAAAACAGACAGAAGGGGG - Intergenic
1194275688 X:91878266-91878288 TCATAAGAACAGTTGGAAGGAGG - Exonic
1194626870 X:96235564-96235586 CAATTAGAACAAAAAGATGGAGG + Intergenic
1195880338 X:109586533-109586555 CAATGAGAACAGGAGGGAGGTGG - Intergenic
1199491230 X:148402965-148402987 TCATAAGAACAGAAGCATGGAGG + Intergenic
1200246999 X:154531724-154531746 CCAGCCCAACAGAAGGAAGGAGG - Exonic
1200367664 X:155684379-155684401 CCGTCAGAACAGAAGGAAAGGGG + Intergenic
1202035975 Y:20635928-20635950 CCATTCTTGCAGAAGGAAGGTGG + Intergenic
1202066949 Y:20950156-20950178 ACAATAGAACAGAGGGGAGGAGG - Intergenic