ID: 1016682454

View in Genome Browser
Species Human (GRCh38)
Location 6:146846106-146846128
Sequence CTGTATTAGCAGCATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016682454_1016682457 7 Left 1016682454 6:146846106-146846128 CCATTCTCATGCTGCTAATACAG No data
Right 1016682457 6:146846136-146846158 CAAGACTGGGTAATTTATAAAGG 0: 1394
1: 2501
2: 4118
3: 3674
4: 2254
1016682454_1016682456 -6 Left 1016682454 6:146846106-146846128 CCATTCTCATGCTGCTAATACAG No data
Right 1016682456 6:146846123-146846145 ATACAGACATACGCAAGACTGGG No data
1016682454_1016682455 -7 Left 1016682454 6:146846106-146846128 CCATTCTCATGCTGCTAATACAG No data
Right 1016682455 6:146846122-146846144 AATACAGACATACGCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016682454 Original CRISPR CTGTATTAGCAGCATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr