ID: 1016684178

View in Genome Browser
Species Human (GRCh38)
Location 6:146862947-146862969
Sequence ATACACTAGTAGAAGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016684178_1016684179 -9 Left 1016684178 6:146862947-146862969 CCATCAAACTTCTACTAGTGTAT 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1016684179 6:146862961-146862983 CTAGTGTATTCATCCACACCTGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016684178 Original CRISPR ATACACTAGTAGAAGTTTGA TGG (reversed) Intergenic
914415822 1:147480779-147480801 ATAAACTAGTAGAAAATTGGTGG + Intergenic
920010179 1:202861456-202861478 ATCCAGTAGTTGAAGTTGGAGGG + Intergenic
920177211 1:204109378-204109400 ATACAGTAGTAGAATCTTGCAGG - Intronic
921742506 1:218702056-218702078 AAACACTGGTAGGAGTTTGGAGG - Intergenic
921950027 1:220919905-220919927 ATACAATAGGGGAAATTTGATGG + Intergenic
1064431619 10:15276092-15276114 ATACACTTGTAGCATTTTGAAGG - Intronic
1066137888 10:32469302-32469324 ATACAGGAGTAGAAGATAGAGGG + Intronic
1066355973 10:34684286-34684308 ATACATTAGAAAAAGTTTGAGGG - Intronic
1068137290 10:52963784-52963806 AGACAGTTGTAGAAGCTTGATGG + Intergenic
1074738365 10:116459744-116459766 AAACACTAGTAGAGATCTGAAGG - Intronic
1077749907 11:4955419-4955441 AGGCACTAGAAGAAGTTTCAGGG + Exonic
1078264656 11:9745702-9745724 ATACACTAATAAACCTTTGATGG + Intronic
1079830639 11:25263452-25263474 ATAAACTGGTAGAAGGTTGTGGG - Intergenic
1081152999 11:39654755-39654777 ATACATTATTTCAAGTTTGAGGG - Intergenic
1085939315 11:81189583-81189605 ATACAGTAGTAAAAATTCGAAGG + Intergenic
1086280408 11:85180089-85180111 ATACTCTAGAAGAAGCTTTATGG + Intronic
1086564294 11:88207600-88207622 TCACACAAGTAGAAGGTTGAAGG - Intergenic
1087239471 11:95758749-95758771 ATACACATGTAAAAGTTAGATGG - Intergenic
1093318567 12:17683069-17683091 CTACATTAGTAAAAGTTTGGGGG + Intergenic
1095282440 12:40370638-40370660 ATACTCTATTAGAAGTATTATGG + Intergenic
1095746296 12:45662425-45662447 GTACAGTAGTAGAAGTTTTCAGG - Intergenic
1099510442 12:83529291-83529313 CTACACTAGTAGCAGGATGAGGG - Intergenic
1102716541 12:114978351-114978373 ATAAACAAATAGAAGTTTAATGG + Intergenic
1105564125 13:21526352-21526374 ATAGACTATTAGAAATTTTATGG - Intronic
1105735296 13:23262854-23262876 ATACATTTGTATAATTTTGAGGG - Intronic
1106368509 13:29107333-29107355 TTACAATAGTAGAATTTTAAGGG + Intronic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1109845403 13:67982529-67982551 ATAAACTAGCAAATGTTTGAAGG - Intergenic
1110006334 13:70275703-70275725 AAAAACTAGAAGAAGTATGAAGG + Intergenic
1110800716 13:79691380-79691402 AGACACTAGAAAAAGATTGAAGG - Intergenic
1111829611 13:93310881-93310903 ATAAAATAGTAGTAGTTAGAAGG - Intronic
1112537842 13:100277770-100277792 ATACCCTAGAAGGAGTTTGGAGG + Intronic
1114017300 14:18442625-18442647 AGACACTAGTAGAGGTTTTCTGG + Intergenic
1114017365 14:18443245-18443267 ATACACTAGGAGAAGTGTTCTGG + Intergenic
1114444261 14:22776163-22776185 TTTCACTAGCAGAAGGTTGAGGG - Intronic
1120955592 14:90079304-90079326 AAAAACTAGTAGGAGTGTGAGGG + Intronic
1124842793 15:33259601-33259623 ATAAACTCCTAGAATTTTGATGG + Intergenic
1131868199 15:96734104-96734126 ATAGACCATTAGAAGCTTGAAGG + Intergenic
1134759321 16:16699632-16699654 TTACACTAGTGGAAGTAAGATGG + Intergenic
1135201275 16:20439679-20439701 AAAAACTAGTAGAACTTTCATGG + Intronic
1135217832 16:20588185-20588207 AAAAACTAGTAGAACTTTCATGG - Intergenic
1135305199 16:21361928-21361950 ATAAACAAGAAGAAGTATGAGGG - Intergenic
1136301943 16:29341093-29341115 ATAAACAAGAAGAAGTATGAGGG - Intergenic
1137942590 16:52703397-52703419 ATACAGTAGAATAAGATTGATGG - Intergenic
1140143299 16:72280613-72280635 ATACACAAGAAGATGCTTGATGG + Intergenic
1141001709 16:80314544-80314566 CTACACTATGAGAAGTTTGAAGG + Intergenic
1142436719 16:90064099-90064121 ATAAACTAGTAGACTTTTGATGG + Intronic
1147992821 17:44345471-44345493 ATACACTAGGGGGAGTTTTATGG + Intronic
1149679701 17:58497006-58497028 ATATACTAGGGGAAGTTTCATGG - Intronic
1150521585 17:65872870-65872892 ATGGACTAGTAGAAGTTACATGG - Intronic
1150921489 17:69488751-69488773 GGAGACTAGTAGAAGCTTGAAGG + Intronic
1155014266 18:21817099-21817121 ATACAGGAGTAGAAGGTAGATGG + Intronic
1155400659 18:25435509-25435531 ATGCACAAATAGAACTTTGAGGG - Intergenic
1156134996 18:34026905-34026927 ATATACTAGTAGAATTTAGATGG - Intronic
1158621188 18:59033900-59033922 ATTCACTAGCAGAATTTAGATGG + Intergenic
1159433868 18:68390403-68390425 ATTCAGTAGCAGAAGATTGAGGG - Intergenic
1167966105 19:53148515-53148537 ATAAACTAGTACAAGTCTAAAGG + Intronic
925542498 2:4980726-4980748 AAACACTAGTGGAAGTTAGGAGG + Intergenic
928053562 2:28027249-28027271 TAACATTAGTAGAAGTTTGAAGG - Intronic
929066752 2:37983636-37983658 ATTAAATAGTAGATGTTTGAGGG + Intronic
939918536 2:148079528-148079550 AGACACAAGTAGAAGTGGGATGG - Intronic
941349660 2:164416519-164416541 ATAAAATAGTAGAACTTAGATGG + Intergenic
941986048 2:171512728-171512750 GTAAACTAGTAGCAGATTGAAGG + Intergenic
942118412 2:172751423-172751445 ATAGAATAGGAGAAGTTAGATGG + Intronic
944979914 2:205105633-205105655 ATACAGTATTAAAAATTTGATGG + Intronic
948045164 2:234937905-234937927 ATAGACTATTAGAAGTATAATGG + Intergenic
1170777858 20:19393816-19393838 AAACACTATTACAATTTTGATGG - Intronic
1170886466 20:20343874-20343896 GTACACAGGTAGAAGTTTGAGGG - Intronic
1172347665 20:34216532-34216554 ATATACTTCTAGAAGTTTTATGG + Intronic
1176991198 21:15498217-15498239 ATATCCAAGTGGAAGTTTGAAGG - Intergenic
1178020843 21:28406700-28406722 ATACAGTAAAAGAAGTTTAATGG + Intergenic
1180441869 22:15374114-15374136 ATACACTAGGAGAAGTGTTCTGG + Intergenic
1183113614 22:35672102-35672124 GTAAACCAGTAGAAGTTTGAAGG + Intergenic
1183383859 22:37503891-37503913 ATACCCAAGGAGAAGCTTGATGG - Intronic
951815693 3:26751774-26751796 ATCCACTGGTAGAAGCCTGAGGG - Intergenic
952026618 3:29090200-29090222 AAACACAATTAGAATTTTGAAGG + Intergenic
952950522 3:38520904-38520926 AAACACTACTAGAGGTTTGGTGG - Intronic
956760739 3:72441890-72441912 GTACTTTAGTAGAAGTTTTATGG - Intronic
957759403 3:84535388-84535410 AGACACTAGTAAAAGGTTGAGGG - Intergenic
962080333 3:132132346-132132368 TCACATTAGTAGAAGTTAGAAGG + Intronic
962543145 3:136403463-136403485 ATACACTAGAAGATGTTCAATGG + Intronic
962820198 3:139041304-139041326 CTACAATACTACAAGTTTGAAGG + Intronic
963245764 3:143059797-143059819 AGATACTAGTATAAGTTTAAAGG + Exonic
963707128 3:148700837-148700859 AAACATTAGGAGAATTTTGAAGG - Intronic
964912431 3:161799547-161799569 ATAGTCTAGTAGAAGTGGGAAGG - Intergenic
966149192 3:176848185-176848207 ATAGCCTAGGAGAAGTTAGATGG + Intergenic
966271065 3:178106358-178106380 ATGCAGCAGTAGAAGTTTGGGGG - Intergenic
970585129 4:17507933-17507955 ATGCACTATTAACAGTTTGATGG - Intronic
972968675 4:44545098-44545120 AGGCACTAGTAGGAGCTTGATGG - Intergenic
974002327 4:56524205-56524227 ATACACGAGTAGAAGTGTGTAGG + Exonic
976007840 4:80452028-80452050 ATCCACTAGTAGAAATATAAAGG + Intronic
976319057 4:83690756-83690778 GTACCCTATAAGAAGTTTGAGGG - Intergenic
978011772 4:103695102-103695124 AAACCATAGTAGAAGTTTGATGG - Intronic
979155680 4:117386622-117386644 GTACATGAGTAGAAATTTGATGG + Intergenic
979416665 4:120449366-120449388 AAAGACTGGTAGAATTTTGATGG - Intergenic
981619896 4:146683330-146683352 AAATACTAGTATAATTTTGAAGG - Intergenic
982729977 4:158945364-158945386 CTACACGAGGAGCAGTTTGATGG + Intronic
987544634 5:19297291-19297313 ATAGAGTAGTCGAAGTTTGGTGG - Intergenic
987644869 5:20656536-20656558 ATATACTACTTGCAGTTTGATGG + Intergenic
990274127 5:54177219-54177241 ATACAGCACTAGAAGTTTGTGGG - Intronic
993010161 5:82471946-82471968 AAACACTATTAAAAGTGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998679749 5:144453777-144453799 ATACGATATTAGAACTTTGATGG - Intronic
1000485645 5:161840047-161840069 ATACTTTAGCAGAAGTTGGATGG + Intergenic
1000808195 5:165824209-165824231 ACACACTAGTCGAAATTTAAGGG - Intergenic
1001133741 5:169085146-169085168 AAACCCCAGTAGAAGTTGGAGGG - Intronic
1001919325 5:175588061-175588083 ATACATTAGAGAAAGTTTGAGGG - Intergenic
1005575693 6:27187322-27187344 GTTGACTAGTAGAAATTTGATGG + Intergenic
1007305758 6:40902974-40902996 AGACACTGGTAGAAGCTTGCAGG + Intergenic
1013625873 6:111936286-111936308 ATACACTTTTAAAACTTTGATGG - Intergenic
1014366929 6:120555360-120555382 ATAGAATATTACAAGTTTGATGG + Intergenic
1016684178 6:146862947-146862969 ATACACTAGTAGAAGTTTGATGG - Intergenic
1017277987 6:152592553-152592575 ATAGACTACTAGAAGGTGGAGGG + Intronic
1017377089 6:153783690-153783712 TTACACATGTAGAAGTTGGAGGG - Intergenic
1019081215 6:169431198-169431220 ATGCACAAAGAGAAGTTTGAGGG - Intergenic
1027903505 7:84149812-84149834 AGACACTAGCATTAGTTTGAAGG + Intronic
1031508694 7:122621251-122621273 ATAAAATAATAGAAGTTTTAAGG - Intronic
1032230093 7:130066895-130066917 AAAGACTATTAGCAGTTTGATGG - Intergenic
1039871512 8:41549678-41549700 ATACAGAAGTAAAAGTTGGATGG - Intergenic
1042580089 8:70267305-70267327 ATAACCTAGTAAAAGTTTGTTGG - Intronic
1044610106 8:94083062-94083084 AGACACTAATAGAAATTTCAAGG - Intergenic
1052013148 9:23434733-23434755 ATACACTAGTATCAGTTAAACGG + Intergenic
1052212033 9:25916163-25916185 ATTAACTAGTAAAAGATTGATGG + Intergenic
1059806865 9:117810824-117810846 ATACACTCCTATAAGGTTGAAGG + Intergenic
1188734480 X:33695842-33695864 AGACACGAATAGAATTTTGATGG + Intergenic
1190215670 X:48478124-48478146 ATCCAGTTGTAGCAGTTTGAAGG - Exonic
1190990179 X:55540525-55540547 CCACACTAGTAGAAGTTGAAAGG - Intergenic
1193691841 X:84655916-84655938 ATACACTAGTAGATGTTCTTTGG + Intergenic
1197474816 X:126908766-126908788 TTACATTAGTTGAATTTTGAAGG - Intergenic
1197989269 X:132299382-132299404 CAACACTAGTGGAAGTATGATGG + Intergenic