ID: 1016686772

View in Genome Browser
Species Human (GRCh38)
Location 6:146890839-146890861
Sequence TAGGAACATCAGCATCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016686772_1016686777 15 Left 1016686772 6:146890839-146890861 CCCCAGCGATGCTGATGTTCCTA No data
Right 1016686777 6:146890877-146890899 TGCACTGAGTCTACACTAGAAGG No data
1016686772_1016686780 29 Left 1016686772 6:146890839-146890861 CCCCAGCGATGCTGATGTTCCTA No data
Right 1016686780 6:146890891-146890913 ACTAGAAGGTCGTCTGGGCTCGG No data
1016686772_1016686778 23 Left 1016686772 6:146890839-146890861 CCCCAGCGATGCTGATGTTCCTA No data
Right 1016686778 6:146890885-146890907 GTCTACACTAGAAGGTCGTCTGG No data
1016686772_1016686779 24 Left 1016686772 6:146890839-146890861 CCCCAGCGATGCTGATGTTCCTA No data
Right 1016686779 6:146890886-146890908 TCTACACTAGAAGGTCGTCTGGG No data
1016686772_1016686781 30 Left 1016686772 6:146890839-146890861 CCCCAGCGATGCTGATGTTCCTA No data
Right 1016686781 6:146890892-146890914 CTAGAAGGTCGTCTGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016686772 Original CRISPR TAGGAACATCAGCATCGCTG GGG (reversed) Intergenic