ID: 1016686789

View in Genome Browser
Species Human (GRCh38)
Location 6:146891019-146891041
Sequence GGGAATGAGCCTATACCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016686789_1016686796 21 Left 1016686789 6:146891019-146891041 CCTGTAGGTATAGGCTCATTCCC No data
Right 1016686796 6:146891063-146891085 GACTTATTCCACCCTCTGGGTGG No data
1016686789_1016686795 18 Left 1016686789 6:146891019-146891041 CCTGTAGGTATAGGCTCATTCCC No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data
1016686789_1016686794 17 Left 1016686789 6:146891019-146891041 CCTGTAGGTATAGGCTCATTCCC No data
Right 1016686794 6:146891059-146891081 CATTGACTTATTCCACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016686789 Original CRISPR GGGAATGAGCCTATACCTAC AGG (reversed) Intergenic
No off target data available for this crispr