ID: 1016686790

View in Genome Browser
Species Human (GRCh38)
Location 6:146891039-146891061
Sequence ATGGAATGGATGAGTTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016686790_1016686794 -3 Left 1016686790 6:146891039-146891061 CCCTGCTAACTCATCCATTCCAT No data
Right 1016686794 6:146891059-146891081 CATTGACTTATTCCACCCTCTGG No data
1016686790_1016686796 1 Left 1016686790 6:146891039-146891061 CCCTGCTAACTCATCCATTCCAT No data
Right 1016686796 6:146891063-146891085 GACTTATTCCACCCTCTGGGTGG No data
1016686790_1016686795 -2 Left 1016686790 6:146891039-146891061 CCCTGCTAACTCATCCATTCCAT No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016686790 Original CRISPR ATGGAATGGATGAGTTAGCA GGG (reversed) Intergenic
No off target data available for this crispr