ID: 1016686795

View in Genome Browser
Species Human (GRCh38)
Location 6:146891060-146891082
Sequence ATTGACTTATTCCACCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016686786_1016686795 30 Left 1016686786 6:146891007-146891029 CCTCGCTTCCTACCTGTAGGTAT No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data
1016686790_1016686795 -2 Left 1016686790 6:146891039-146891061 CCCTGCTAACTCATCCATTCCAT No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data
1016686789_1016686795 18 Left 1016686789 6:146891019-146891041 CCTGTAGGTATAGGCTCATTCCC No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data
1016686791_1016686795 -3 Left 1016686791 6:146891040-146891062 CCTGCTAACTCATCCATTCCATT No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data
1016686788_1016686795 22 Left 1016686788 6:146891015-146891037 CCTACCTGTAGGTATAGGCTCAT No data
Right 1016686795 6:146891060-146891082 ATTGACTTATTCCACCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016686795 Original CRISPR ATTGACTTATTCCACCCTCT GGG Intergenic
No off target data available for this crispr