ID: 1016690050

View in Genome Browser
Species Human (GRCh38)
Location 6:146927277-146927299
Sequence TGTTCACTAGAGAAATGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016690050_1016690054 -6 Left 1016690050 6:146927277-146927299 CCTCTACATTTCTCTAGTGAACA No data
Right 1016690054 6:146927294-146927316 TGAACATTGTCAGGGGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016690050 Original CRISPR TGTTCACTAGAGAAATGTAG AGG (reversed) Intergenic
No off target data available for this crispr