ID: 1016693777

View in Genome Browser
Species Human (GRCh38)
Location 6:146968814-146968836
Sequence AAATAGCCACAGTTTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016693776_1016693777 3 Left 1016693776 6:146968788-146968810 CCTGCAATATCTTAACAGTTTCA No data
Right 1016693777 6:146968814-146968836 AAATAGCCACAGTTTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016693777 Original CRISPR AAATAGCCACAGTTTGAGAA TGG Intergenic
No off target data available for this crispr