ID: 1016694211

View in Genome Browser
Species Human (GRCh38)
Location 6:146973966-146973988
Sequence CAAGAAGGGTGGCTCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016694211_1016694216 -8 Left 1016694211 6:146973966-146973988 CCACTCTGGAGCCACCCTTCTTG No data
Right 1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data
1016694211_1016694218 16 Left 1016694211 6:146973966-146973988 CCACTCTGGAGCCACCCTTCTTG No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694211_1016694219 17 Left 1016694211 6:146973966-146973988 CCACTCTGGAGCCACCCTTCTTG No data
Right 1016694219 6:146974006-146974028 TCATACCTTTTCTTATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016694211 Original CRISPR CAAGAAGGGTGGCTCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr