ID: 1016694216

View in Genome Browser
Species Human (GRCh38)
Location 6:146973981-146974003
Sequence CCTTCTTGCCAAAAGGAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016694208_1016694216 2 Left 1016694208 6:146973956-146973978 CCCTTGGGACCCACTCTGGAGCC No data
Right 1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data
1016694210_1016694216 -7 Left 1016694210 6:146973965-146973987 CCCACTCTGGAGCCACCCTTCTT No data
Right 1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data
1016694209_1016694216 1 Left 1016694209 6:146973957-146973979 CCTTGGGACCCACTCTGGAGCCA No data
Right 1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data
1016694206_1016694216 8 Left 1016694206 6:146973950-146973972 CCACTTCCCTTGGGACCCACTCT No data
Right 1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data
1016694211_1016694216 -8 Left 1016694211 6:146973966-146973988 CCACTCTGGAGCCACCCTTCTTG No data
Right 1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016694216 Original CRISPR CCTTCTTGCCAAAAGGAATG CGG Intergenic
No off target data available for this crispr