ID: 1016694218

View in Genome Browser
Species Human (GRCh38)
Location 6:146974005-146974027
Sequence ATCATACCTTTTCTTATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016694217_1016694218 -7 Left 1016694217 6:146973989-146974011 CCAAAAGGAATGCGGTATCATAC No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694214_1016694218 2 Left 1016694214 6:146973980-146974002 CCCTTCTTGCCAAAAGGAATGCG No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694210_1016694218 17 Left 1016694210 6:146973965-146973987 CCCACTCTGGAGCCACCCTTCTT No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694208_1016694218 26 Left 1016694208 6:146973956-146973978 CCCTTGGGACCCACTCTGGAGCC No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694215_1016694218 1 Left 1016694215 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694211_1016694218 16 Left 1016694211 6:146973966-146973988 CCACTCTGGAGCCACCCTTCTTG No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694213_1016694218 5 Left 1016694213 6:146973977-146973999 CCACCCTTCTTGCCAAAAGGAAT No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data
1016694209_1016694218 25 Left 1016694209 6:146973957-146973979 CCTTGGGACCCACTCTGGAGCCA No data
Right 1016694218 6:146974005-146974027 ATCATACCTTTTCTTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016694218 Original CRISPR ATCATACCTTTTCTTATTTC AGG Intergenic
No off target data available for this crispr