ID: 1016698399

View in Genome Browser
Species Human (GRCh38)
Location 6:147025577-147025599
Sequence TTTATAAAGGGCAGTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016698399_1016698402 1 Left 1016698399 6:147025577-147025599 CCATGCTTACTGCCCTTTATAAA No data
Right 1016698402 6:147025601-147025623 GATTCAAGCTTTCTAAGTTCAGG No data
1016698399_1016698403 2 Left 1016698399 6:147025577-147025599 CCATGCTTACTGCCCTTTATAAA No data
Right 1016698403 6:147025602-147025624 ATTCAAGCTTTCTAAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016698399 Original CRISPR TTTATAAAGGGCAGTAAGCA TGG (reversed) Intergenic
No off target data available for this crispr