ID: 1016702396

View in Genome Browser
Species Human (GRCh38)
Location 6:147068267-147068289
Sequence ACTACAGCAGTAATTATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016702396_1016702397 0 Left 1016702396 6:147068267-147068289 CCAGGAATAATTACTGCTGTAGT No data
Right 1016702397 6:147068290-147068312 TAATGACCTGTAGCATGCTTTGG No data
1016702396_1016702399 22 Left 1016702396 6:147068267-147068289 CCAGGAATAATTACTGCTGTAGT No data
Right 1016702399 6:147068312-147068334 GTCCATTAACTCCTCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016702396 Original CRISPR ACTACAGCAGTAATTATTCC TGG (reversed) Intergenic
No off target data available for this crispr