ID: 1016702397

View in Genome Browser
Species Human (GRCh38)
Location 6:147068290-147068312
Sequence TAATGACCTGTAGCATGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016702396_1016702397 0 Left 1016702396 6:147068267-147068289 CCAGGAATAATTACTGCTGTAGT No data
Right 1016702397 6:147068290-147068312 TAATGACCTGTAGCATGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016702397 Original CRISPR TAATGACCTGTAGCATGCTT TGG Intergenic
No off target data available for this crispr