ID: 1016702513

View in Genome Browser
Species Human (GRCh38)
Location 6:147069621-147069643
Sequence ACGGGTACAATCTGTAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016702507_1016702513 23 Left 1016702507 6:147069575-147069597 CCTCAGTCTTCTTGGATGTGGGA No data
Right 1016702513 6:147069621-147069643 ACGGGTACAATCTGTAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016702513 Original CRISPR ACGGGTACAATCTGTAACAT AGG Intergenic
No off target data available for this crispr