ID: 1016709396

View in Genome Browser
Species Human (GRCh38)
Location 6:147152840-147152862
Sequence CAAACAAAGGAGAAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016709396_1016709401 -3 Left 1016709396 6:147152840-147152862 CCTGCCCTCTTCTCCTTTGTTTG No data
Right 1016709401 6:147152860-147152882 TTGGATTACACTTACTTATCTGG No data
1016709396_1016709402 16 Left 1016709396 6:147152840-147152862 CCTGCCCTCTTCTCCTTTGTTTG No data
Right 1016709402 6:147152879-147152901 CTGGAATTGAAATTTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016709396 Original CRISPR CAAACAAAGGAGAAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr