ID: 1016711417

View in Genome Browser
Species Human (GRCh38)
Location 6:147176890-147176912
Sequence CCTGGGAGATTGATTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016711417_1016711422 -2 Left 1016711417 6:147176890-147176912 CCAGTAACAATCAATCTCCCAGG No data
Right 1016711422 6:147176911-147176933 GGAGACAAATGCAAGGAACCAGG No data
1016711417_1016711423 13 Left 1016711417 6:147176890-147176912 CCAGTAACAATCAATCTCCCAGG No data
Right 1016711423 6:147176926-147176948 GAACCAGGTTCTTTCATACCTGG No data
1016711417_1016711424 14 Left 1016711417 6:147176890-147176912 CCAGTAACAATCAATCTCCCAGG No data
Right 1016711424 6:147176927-147176949 AACCAGGTTCTTTCATACCTGGG No data
1016711417_1016711419 -9 Left 1016711417 6:147176890-147176912 CCAGTAACAATCAATCTCCCAGG No data
Right 1016711419 6:147176904-147176926 TCTCCCAGGAGACAAATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016711417 Original CRISPR CCTGGGAGATTGATTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr