ID: 1016715172

View in Genome Browser
Species Human (GRCh38)
Location 6:147218122-147218144
Sequence GGCTACGAATGTTTTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016715172_1016715176 -1 Left 1016715172 6:147218122-147218144 CCTGTCCCAAAACATTCGTAGCC 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1016715176 6:147218144-147218166 CTCCTCCATTATCAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016715172 Original CRISPR GGCTACGAATGTTTTGGGAC AGG (reversed) Intronic