ID: 1016722583

View in Genome Browser
Species Human (GRCh38)
Location 6:147319641-147319663
Sequence TAGCGTTTGGTGTCAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016722583 Original CRISPR TAGCGTTTGGTGTCAGATAG AGG Intronic
908045209 1:60161393-60161415 CAGGGTTTAGTGTCAGATATGGG - Intergenic
909062474 1:70894887-70894909 TGGATTTTGGTGTCAGATATAGG - Intronic
912885302 1:113465174-113465196 TTGTGTTTGGTGAGAGATAGTGG + Intronic
916877922 1:168989854-168989876 TAGTGTGTGGTGTAAGAGAGGGG - Intergenic
918430742 1:184458092-184458114 TAGGCTTTGGAGTCAGATTGGGG - Intronic
918779601 1:188681757-188681779 TAGCATGTGGTATGAGATAGGGG + Intergenic
920083782 1:203398770-203398792 TTGTGTATGGTGTCAGATAAGGG + Intergenic
922215037 1:223513261-223513283 TTGCGATTGGTGTCAGAGTGAGG + Intergenic
1063221334 10:3971029-3971051 TTGCATTTTGTGTCAGATATTGG + Intergenic
1068293070 10:55031548-55031570 TAGGGCTTGGTGTCAGATTCAGG + Intronic
1069204597 10:65666027-65666049 TAAAGTTTGGTGTCAGATACTGG - Intergenic
1069758310 10:70787647-70787669 TTGTGTTTGGTGTAAGATAGGGG + Intergenic
1072297143 10:94020639-94020661 TTGTGTGTGGTGTGAGATAGGGG + Intronic
1074180191 10:111054943-111054965 TTGCGTATGGTGTGAGGTAGGGG + Intergenic
1077381060 11:2237830-2237852 TGGCGTGTGGTGTTAGATAGGGG + Intergenic
1082097375 11:48142021-48142043 TTGTGTCTGGTGTAAGATAGAGG + Intronic
1087316595 11:96610524-96610546 TATAGTTTGAAGTCAGATAGGGG + Intergenic
1088786161 11:113183454-113183476 GAGGGTTTGCTGTCAGGTAGTGG + Intronic
1091970013 12:4779270-4779292 TAGAGTTTGGTCCCAGATATGGG + Intronic
1095485962 12:42684957-42684979 GTGTGTTTGCTGTCAGATAGTGG - Intergenic
1096216643 12:49801463-49801485 TAGGGTATGGTGTCACAGAGAGG - Intronic
1098984293 12:76994372-76994394 TAGTGTATGGTGTGAGATAAGGG - Intergenic
1099738043 12:86596265-86596287 TTGAGTTTGATGTCAGATACTGG - Intronic
1101543933 12:105692105-105692127 TGGCATATGGTGACAGATAGGGG + Intergenic
1104475666 12:129068647-129068669 TATCGTTTGGGGTCAGATGTGGG + Intergenic
1112429296 13:99336495-99336517 TTACGTTTGGTGTCAGGAAGGGG + Intronic
1117310952 14:54522338-54522360 TAGCATTAAGTGTCAGAAAGAGG - Intronic
1118728263 14:68647389-68647411 TGGCTTTTGGTTTAAGATAGAGG + Intronic
1121767720 14:96502226-96502248 TAGCAGTGGGTGTCAGATGGTGG - Intronic
1121905825 14:97742050-97742072 TTGTGTATGGTGTCAGATAAAGG + Intergenic
1122604202 14:102937688-102937710 TGGCGCTTGGTGTCAGAGTGTGG - Intronic
1123226588 15:17041998-17042020 GAGCGTTTTGTGTCCTATAGTGG + Intergenic
1126282474 15:46971278-46971300 TATCATTTGAGGTCAGATAGTGG - Intergenic
1129581356 15:76814580-76814602 TTGCGTATGGTGTAAGATAAGGG - Intronic
1130282164 15:82527944-82527966 TACCTTTTGGTTTCAGTTAGAGG + Intergenic
1131942986 15:97587217-97587239 TGGGGTATGGTGTAAGATAGGGG - Intergenic
1132967603 16:2667531-2667553 TATAGTTTGGTGTCGGATTGCGG + Intergenic
1138326599 16:56176674-56176696 CAGCATTTGGTGTGAGGTAGAGG + Intergenic
1140539548 16:75744122-75744144 TTGAGTTTGGTGTCAGATACTGG - Intronic
1143698658 17:8640313-8640335 TAGGGTTTGGTGTCAGATTTAGG - Intergenic
1149363594 17:55918633-55918655 TTGTGTATGGTGTAAGATAGGGG - Intergenic
1155090264 18:22502202-22502224 TTGTGTTTGGTGTGAGATAGGGG - Intergenic
1156001081 18:32384911-32384933 TAGTTTTTGTGGTCAGATAGAGG - Intronic
1156125773 18:33903522-33903544 TTGAGTTTGGTGTCAGATAATGG - Intronic
1156152067 18:34254237-34254259 TTGAGTTTGGTGTCAGAGAGTGG + Intergenic
1156400660 18:36736625-36736647 TGTCGTTTGATGTCAGAGAGAGG - Intronic
1156896373 18:42251112-42251134 TATAGTTTGAAGTCAGATAGTGG + Intergenic
1165200628 19:34141502-34141524 TTGTGTTTGGTGTTAGGTAGGGG - Intergenic
926533320 2:14080071-14080093 TAGCCTTTGGAATCAGATACTGG - Intergenic
928290423 2:30032023-30032045 TTGTGTGTGGTGTGAGATAGGGG - Intergenic
936891084 2:117371048-117371070 TTACGTTTGGTGTCAGATATTGG - Intergenic
936969405 2:118162947-118162969 TTGCGTATGGTGTCAGATAAAGG - Intergenic
938877078 2:135543145-135543167 TTGTGTATGGTGTGAGATAGGGG + Intronic
942063754 2:172251282-172251304 GACCGTTTGGTGTCAAATTGTGG - Intergenic
942357151 2:175128527-175128549 TTGTGTATGGTGTGAGATAGGGG - Intronic
943440434 2:187921447-187921469 TTAAGTTTGGTGTCAGATACTGG - Intergenic
944530418 2:200662512-200662534 TAGCGTTTGGTGTAAAATGAAGG + Intronic
944970769 2:204990886-204990908 TAGCATATGGTGTGAGATAGGGG + Intronic
946479755 2:220043284-220043306 TAGTGTATGGTGTGAGATATAGG + Intergenic
1168844020 20:930068-930090 TTGAGTTTGGTGTCAGATACTGG + Intergenic
1169407251 20:5332282-5332304 TTGAGTTTGGTGTCAGATACCGG + Intergenic
1170063137 20:12281562-12281584 TTGTGTATGGTGACAGATAGGGG - Intergenic
1170253037 20:14306904-14306926 TATGGTTTGGTATCAAATAGTGG - Intronic
1174894687 20:54436122-54436144 TAGCCTTTTGTTTCAGATATCGG - Intergenic
1180411472 22:12613794-12613816 TTGTGTTTGGTGTTAGATAAGGG + Intergenic
1181843278 22:25684029-25684051 TAGCGTATGGTGTGAGGCAGGGG + Intronic
1183611053 22:38906337-38906359 TCGAGTTTGGTGTCAGAGACTGG - Intergenic
951759675 3:26131945-26131967 TAGAGCTGGGTGTGAGATAGGGG - Intergenic
951834577 3:26968097-26968119 TTATGTTTGGTGTAAGATAGAGG + Intergenic
953146722 3:40283326-40283348 TTGCATATGGTGTGAGATAGTGG + Intergenic
955783682 3:62513260-62513282 ATGCGTTAGGTGTCAGATAAAGG - Intronic
959637576 3:108592280-108592302 TAGGATTTGGTGACTGATAGTGG + Intronic
962851848 3:139314027-139314049 TAGCTTTTGGTGACAGCTGGAGG - Intronic
963910677 3:150815061-150815083 TTGAGTTTGATGTCAGATATTGG + Intergenic
966586607 3:181633568-181633590 TAGCGTTTGGTGCAGGGTAGGGG + Intergenic
966994424 3:185265984-185266006 TTGGGTTTGGTGTGAGATACTGG - Intronic
968781597 4:2586401-2586423 TTGTGTATGGTGTGAGATAGGGG + Intronic
975884357 4:78946566-78946588 TATAGTTTGAAGTCAGATAGTGG + Intergenic
977080868 4:92525833-92525855 TAGCATTTGGAGCCAGAGAGAGG + Intronic
979096873 4:116562351-116562373 AAGTGTTTGTTATCAGATAGAGG + Intergenic
980457479 4:133064333-133064355 TAGCTTTTGGGGACAGAAAGGGG + Intergenic
981266561 4:142790925-142790947 TTGTGTTTGGTGTTAGAGAGTGG - Intronic
981500852 4:145449898-145449920 TACTGTTTGGAGTCAGAAAGAGG + Intergenic
991219109 5:64191963-64191985 TTGCATATGGTGTAAGATAGGGG + Intronic
994596043 5:101836401-101836423 CAGATTTTGGTGTCAGATACTGG + Intergenic
996139857 5:119893707-119893729 TAGTCTTTGGTGTCACATAATGG + Intergenic
1002682120 5:180974382-180974404 TTGTGTGTGGTGTAAGATAGGGG - Intergenic
1011537209 6:88389252-88389274 TTGCCTTTGGAGTGAGATAGGGG + Intergenic
1016491730 6:144612192-144612214 TTGCCTATGGTGTAAGATAGGGG - Intronic
1016722583 6:147319641-147319663 TAGCGTTTGGTGTCAGATAGAGG + Intronic
1020415182 7:7937455-7937477 TGGCATGTGGTGTGAGATAGGGG - Intronic
1024148487 7:46542364-46542386 TTGAGTTTGGCGTCAGATAATGG - Intergenic
1039378774 8:37064792-37064814 TTGTGTATGGTGTGAGATAGGGG + Intergenic
1043258637 8:78168752-78168774 TTGTGTATGGTGTGAGATAGGGG - Intergenic
1045196223 8:99933569-99933591 TTGTGTATGGTGTAAGATAGGGG - Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047169037 8:122472402-122472424 TTGCATTTGGTGTCAGGAAGGGG - Intergenic
1051352385 9:16209880-16209902 TTGTGTATGGTGTGAGATAGGGG + Intronic
1052127442 9:24794951-24794973 TTGCGTATGGTGTAAGATAAGGG - Intergenic
1052482281 9:29046562-29046584 TTGTGTTTGGTGTAAGAAAGGGG - Intergenic
1056965276 9:91159897-91159919 CAGCGTCTGGTGTCAGAAACTGG - Intergenic
1057382385 9:94580883-94580905 TTGAGTTTGGTATCAGATACTGG - Intronic
1058765745 9:108181210-108181232 TAGGGCTTGGTGGGAGATAGGGG + Intergenic
1202803993 9_KI270720v1_random:32978-33000 TTGTGTTTGGTGTTAGATAACGG - Intergenic
1185906709 X:3940164-3940186 TAGTGTTTGGTGCCATCTAGTGG - Intergenic
1186769885 X:12807163-12807185 TAGCATTTGGTGTCTGGTACGGG + Intronic
1187527409 X:20066623-20066645 AAGAGTTTGGAGTCAGATTGCGG - Intronic
1188230603 X:27658548-27658570 ATGCTTTTGGTGTGAGATAGGGG - Intronic
1190270890 X:48862620-48862642 TTGTGTATGGTGTAAGATAGGGG - Intergenic
1190689662 X:52902845-52902867 TAACTGTTTGTGTCAGATAGTGG + Intronic
1190696321 X:52952947-52952969 TAACTGTTTGTGTCAGATAGTGG - Intronic
1190707713 X:53044495-53044517 TTGAGCTTGGTGTCAGATACTGG - Intergenic
1191007903 X:55729943-55729965 TAGGTTTTGGAGTCAGATTGGGG + Intronic
1192227611 X:69239903-69239925 TAGCCTTTGGTGTCTTATTGTGG - Intergenic
1192379183 X:70597587-70597609 TTGTGTATGGTGTGAGATAGGGG - Intronic
1196161047 X:112482897-112482919 TTGTGTTTGGTGTAAGATAAGGG + Intergenic
1196873052 X:120130917-120130939 TTGAGTCTGGTGTCAGATACTGG + Intergenic