ID: 1016725197

View in Genome Browser
Species Human (GRCh38)
Location 6:147357165-147357187
Sequence CTATAGGTATGTAGTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016725197 Original CRISPR CTATAGGTATGTAGTCAAGA GGG Intronic
908886051 1:68789743-68789765 CTAAAGGTTTGTAGCCAAGGAGG - Intergenic
912419689 1:109534762-109534784 CCATAGGAATGTACTCAAAATGG + Intergenic
919882999 1:201913057-201913079 CTAAAGGAATGTAGTAAACAAGG + Intronic
920904304 1:210146859-210146881 CTATATGTATGTAGTATATATGG + Intronic
921860122 1:220034290-220034312 GTATAGGTTTGTAGTCTAGAAGG + Intronic
1064341780 10:14492387-14492409 CTATAGGTCAGAAGTCTAGATGG - Intergenic
1068472017 10:57477435-57477457 CTATAGGAAAGTAGTAATGATGG - Intergenic
1075130389 10:119733061-119733083 CTATCACTTTGTAGTCAAGAAGG - Intronic
1078752828 11:14181100-14181122 CTATAGGCATGAACTCCAGAAGG + Intronic
1079107887 11:17585213-17585235 CTATAAATATTTAGCCAAGAAGG - Intronic
1079519650 11:21311400-21311422 ATATACGTATGTAAACAAGAAGG - Intronic
1079839900 11:25383227-25383249 CAATTTGTATGTAGCCAAGAGGG - Intergenic
1081435626 11:43024419-43024441 CTGTCGAGATGTAGTCAAGATGG - Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1085413333 11:76304851-76304873 CTCTAGGAATCTAGTCAATATGG - Intergenic
1086730482 11:90242652-90242674 AAATAGGTATGTAGAGAAGAAGG - Intergenic
1088096326 11:106105114-106105136 CTATCACAATGTAGTCAAGAGGG + Intergenic
1088513752 11:110605077-110605099 GTATAGGAATGTAGAAAAGAAGG + Intronic
1092345533 12:7711669-7711691 CTATAGTCAGATAGTCAAGAAGG - Intronic
1094156887 12:27346743-27346765 CCATAGGTGTGTAGTTGAGATGG + Intronic
1097938131 12:65276263-65276285 TTATAGGAATGTGGTCAAGGGGG + Intergenic
1098485235 12:71013467-71013489 CTATATAAATGTAGTCAACAAGG - Intergenic
1103387535 12:120544909-120544931 CTGTAAGTATGTGGCCAAGAAGG + Intronic
1106065403 13:26343257-26343279 GTATAGGTTTGTAGCCTAGAAGG - Intronic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1113174692 13:107548752-107548774 CTACAAGTAGATAGTCAAGAAGG - Intronic
1114039815 14:18667328-18667350 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114044856 14:18865878-18865900 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114119367 14:19653644-19653666 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
1120657557 14:87212050-87212072 CTATAGGTAGGTTTTCAAGTTGG - Intergenic
1120785224 14:88528045-88528067 CTATAGGCTTGTAGTCCAGTTGG + Intronic
1134784560 16:16929920-16929942 CTTTAGATTTGTAGTCCAGAGGG + Intergenic
1137663612 16:50233471-50233493 CTAAGGGTGTGAAGTCAAGATGG - Intronic
1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166168893 19:41012949-41012971 TTATAGGGTTGTAGTGAAGATGG - Intronic
1166662789 19:44658045-44658067 ATATAGGTATGGAGTTAACAGGG - Intronic
927626966 2:24731914-24731936 TTTCAGGTATGTAGTCAAAATGG - Intronic
931298572 2:60954793-60954815 CTATAGGTATGCAATCAGGATGG + Intronic
938270736 2:129968279-129968301 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
942619446 2:177831974-177831996 CAGTAGGTATCTAGTCAGGAAGG + Intronic
1173242513 20:41310055-41310077 CTAAAGGTATCTAGGCTAGATGG - Intronic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1178969703 21:37162208-37162230 CTATATAAATGTAATCAAGATGG - Intronic
1180463379 22:15588438-15588460 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
954526766 3:51278865-51278887 CTATAGGTAATTCGTCATGAGGG - Intronic
956352339 3:68351450-68351472 CCATAGGTTTGTAGTTAAAATGG + Intronic
957102264 3:75842889-75842911 CTCTAGCTATGTTTTCAAGATGG - Intergenic
957118165 3:76054539-76054561 CAATAGGCATGTAAACAAGAAGG - Intronic
960926596 3:122800615-122800637 CTGTAGCCATGTAGGCAAGATGG + Intronic
961487071 3:127224113-127224135 CGACAGGTATGTACTCATGATGG + Intergenic
962486438 3:135847321-135847343 CTAAAGGAATGTAGTCAGAAGGG - Intergenic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
962726985 3:138238802-138238824 CTAAAGGAATGTAATCAAAAAGG + Intronic
969141789 4:5080969-5080991 CAGTAGGATTGTAGTCAAGACGG - Intronic
970092469 4:12426099-12426121 TAATAGGAATGTAGTCAAGGTGG + Intergenic
971171569 4:24238947-24238969 CTATAGATATTTACTAAAGATGG + Intergenic
971522605 4:27573317-27573339 CAATAGGTTTGTAGTCTGGAAGG + Intergenic
973539267 4:51919864-51919886 TTTTAGAGATGTAGTCAAGAAGG + Intergenic
973552084 4:52045951-52045973 TTATAAGCATGTAGTCAATATGG - Intergenic
974392415 4:61289209-61289231 CTCAAGGTATGTATTCATGAGGG + Intronic
975000106 4:69214134-69214156 CAATAGGTATGTAGGAAGGAGGG + Exonic
975014074 4:69390056-69390078 CAATAGGTATGTAGGAAGGAGGG - Intronic
975015330 4:69409403-69409425 CAATAGGTATGTAGGAAGGAGGG - Intronic
975654325 4:76626432-76626454 CAATGGGTATGTATTTAAGAAGG - Intronic
976020444 4:80617535-80617557 CAAGAGGTCTGTAGTCTAGAGGG + Intronic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
979782699 4:124673748-124673770 CTTTAAGTATGTAGACAAAATGG + Intronic
982038778 4:151373930-151373952 CTATAGGAATGTAGAGAAGCAGG - Intergenic
982865363 4:160503759-160503781 GTATAAGTATGTAGTCTAAATGG + Intergenic
985799355 5:1994159-1994181 CTTAAAGTATGTAGCCAAGAAGG + Intergenic
985799394 5:1994383-1994405 TAACAAGTATGTAGTCAAGATGG + Intergenic
985799469 5:1994895-1994917 TAACAGGTATGTAGCCAAGATGG + Intergenic
985871678 5:2562481-2562503 CTATGGGTATTTAGTCATTATGG + Intergenic
987158829 5:15118677-15118699 CTATAGGTATGTCGTGAATTTGG + Intergenic
987577037 5:19743242-19743264 CTATATGTATATAGTCCAGTAGG + Intronic
988258605 5:28852510-28852532 CTATAGGTCTGAGTTCAAGAGGG + Intergenic
994523978 5:100880454-100880476 CCATAGGTATGTGGGTAAGAGGG + Intronic
999417797 5:151415009-151415031 GTCAAGGTATGGAGTCAAGAGGG + Intergenic
999881138 5:155865427-155865449 ATATAGGTATGTAGTGGAAAGGG + Intergenic
1000139148 5:158384452-158384474 CTATATGTATTTAGTCAGAATGG + Intergenic
1002336292 5:178480736-178480758 CTCTAGGTATCTAGTCAACAAGG + Intronic
1003440372 6:6135234-6135256 CTATAGGTTAGAAGTCAGGATGG - Intergenic
1007472699 6:42101099-42101121 CTAAAAGTATGACGTCAAGATGG + Exonic
1014473326 6:121842688-121842710 CTATAGGGATGTAGTCTCCAGGG + Intergenic
1015148859 6:130017901-130017923 CTTAAGGTATTCAGTCAAGATGG - Intronic
1016725197 6:147357165-147357187 CTATAGGTATGTAGTCAAGAGGG + Intronic
1022015375 7:26344799-26344821 CTATAAGAAGCTAGTCAAGAGGG - Intronic
1022407044 7:30100181-30100203 CTTTACGGATATAGTCAAGATGG - Intronic
1038239410 8:25794764-25794786 CTATATTTATGTAAACAAGATGG - Intergenic
1041185357 8:55294466-55294488 CTAAAGGGATGTAGTCGAGGTGG + Intronic
1041594915 8:59638175-59638197 CTAAAAATATGTACTCAAGATGG - Intergenic
1041717285 8:60943692-60943714 ATATAGGTGTGCAGTCAGGAAGG - Intergenic
1043278212 8:78428145-78428167 ATTTAAGTATGAAGTCAAGAGGG - Intergenic
1044277076 8:90313671-90313693 TTATAGCTGTATAGTCAAGAAGG - Intergenic
1047098580 8:121651234-121651256 CTGTAAGTATGTAGTTTAGAAGG + Intergenic
1050770124 9:9188096-9188118 CCATAGGTTAGAAGTCAAGATGG - Intronic
1057108147 9:92440703-92440725 TTATAAGTATTTAGTTAAGAGGG + Intronic
1187441315 X:19323209-19323231 TTCTAGGTATCTACTCAAGAGGG - Intergenic
1187450142 X:19388783-19388805 CTCTAGGTATCTACCCAAGAAGG + Intronic
1190599140 X:52071356-52071378 TTATAGGTATTTAGGCGAGACGG + Intergenic
1190609684 X:52182717-52182739 TTATAGGTATTTAGGCGAGACGG - Intergenic
1194253667 X:91609608-91609630 GTACAGGTTTGTAGTCTAGAAGG - Intergenic
1194610972 X:96044016-96044038 GGATAGGAATGTAATCAAGAAGG - Intergenic
1199503993 X:148541214-148541236 CTATAGTTATCTATTCAACATGG + Intronic
1200572452 Y:4849186-4849208 GTACAGGTTTGTAGTCTAGAAGG - Intergenic