ID: 1016725331

View in Genome Browser
Species Human (GRCh38)
Location 6:147358696-147358718
Sequence CTGTATTCATGTAATAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016725331 Original CRISPR CTGTATTCATGTAATAAAGT AGG Intronic
901615096 1:10532685-10532707 CTGAATTTATGTAATTTAGTTGG + Intronic
906563707 1:46780443-46780465 CTGTCTCCATGAAATAAATTAGG + Intronic
909183658 1:72457208-72457230 CATGATTCATGTAATACAGTAGG + Intergenic
911646616 1:100343793-100343815 TTGTATTCTTATGATAAAGTAGG - Intergenic
912478591 1:109959994-109960016 CTGTATTCATGTGATAAGCCAGG - Intergenic
915181809 1:154068177-154068199 CTGTAGCCTTGTAATATAGTTGG - Intronic
915840747 1:159211083-159211105 CTTTATTCATGAAATTAACTTGG - Intergenic
917049811 1:170908272-170908294 CTGTATAAATGTAATAAATGTGG + Intergenic
917555088 1:176077110-176077132 CTGGATTCATAGAATAAATTAGG - Intronic
918368745 1:183837597-183837619 ATGTATTCCTTTTATAAAGTAGG + Intronic
918720959 1:187850984-187851006 CTGTATCTATCTAATATAGTGGG + Intergenic
918763564 1:188447746-188447768 ATGTATTCAAGTAATGAAGTTGG + Intergenic
920613308 1:207464092-207464114 CTTTTTGCATGGAATAAAGTTGG - Intronic
922636155 1:227173768-227173790 CGGTATCCATGTAATAAAATCGG + Intronic
923422643 1:233833680-233833702 CTGTGTTCATGAAAAAAATTGGG + Intergenic
923846868 1:237743982-237744004 CTGTTTTCAAGTAATAAAACTGG - Intronic
924329155 1:242925058-242925080 CTGGACTCATGTAAGAAAGAAGG + Intergenic
924848931 1:247804181-247804203 CTCTATTAATATAATAAAGACGG + Intergenic
1065572722 10:27088433-27088455 CAGTATCCATGTATAAAAGTCGG - Intronic
1067393561 10:45888799-45888821 CTTTATTCTTACAATAAAGTTGG - Intergenic
1067861885 10:49857942-49857964 CTTTATTCTTACAATAAAGTTGG - Intronic
1068064820 10:52116384-52116406 ATTCATTCATGTAATAGAGTAGG - Intronic
1069431322 10:68337606-68337628 CTTTTTTCATGTAATATAGGTGG + Intronic
1069471503 10:68695289-68695311 CTGTAATAATGTTAGAAAGTAGG - Intergenic
1071170494 10:82858345-82858367 CTGTTTTGCTGTAATAAACTGGG + Intronic
1072508213 10:96091070-96091092 CAGTACTCACATAATAAAGTGGG + Intergenic
1073784766 10:106877279-106877301 CTCTATTCAAAGAATAAAGTGGG + Intronic
1074995239 10:118751506-118751528 CTGGATACATGTATAAAAGTTGG - Intronic
1079051443 11:17163992-17164014 CTTTATCTATGAAATAAAGTTGG - Intronic
1082678151 11:56134885-56134907 GTGTATGCATGTAATAATCTGGG - Intergenic
1086479094 11:87214686-87214708 CTGTAGTGATGTAATATAGGGGG - Intronic
1089898084 11:121952203-121952225 CTGTATTCATATATATAAGTGGG + Intergenic
1090607971 11:128443684-128443706 CTATATTCATATTAAAAAGTAGG - Intergenic
1091524167 12:1280422-1280444 CTTTATTCATTTATTAAAGAGGG - Intronic
1091632794 12:2174799-2174821 GTGTATTCTTACAATAAAGTAGG + Intronic
1091995604 12:4990936-4990958 CTGTGTTCCTGGCATAAAGTAGG + Intergenic
1092642134 12:10524380-10524402 CTGTAGGCATTTCATAAAGTGGG + Intergenic
1094189715 12:27685337-27685359 CTTTATACATGTAAAAAAGTAGG - Intronic
1095402499 12:41831098-41831120 ATTTATTCATGTAATAAAAATGG - Intergenic
1095530144 12:43177622-43177644 CTGTAATCCTGCAATTAAGTTGG + Intergenic
1096383393 12:51177991-51178013 TTGTATTCTTACAATAAAGTAGG - Intergenic
1098535954 12:71593735-71593757 CTGTCTTCAAGTAAGAAATTTGG + Intergenic
1099792366 12:87351764-87351786 CTTTATTCCTGTAATATTGTAGG + Intergenic
1100936076 12:99668036-99668058 CTGACTTCATATAATAAATTGGG + Intronic
1101458156 12:104859377-104859399 CATCATTCAAGTAATAAAGTAGG - Intronic
1101478554 12:105074745-105074767 ATGTATGCCTCTAATAAAGTGGG - Intronic
1102620666 12:114192117-114192139 CTGTATTCCTGGCATACAGTAGG - Intergenic
1104531638 12:129576810-129576832 CTGTATTCTTAGAATCAAGTAGG + Intronic
1105325485 13:19367092-19367114 CTGTATTCCTCTAATTCAGTAGG - Intergenic
1106291539 13:28367660-28367682 CTGCATTTATGTAATCAAATAGG - Intronic
1108100669 13:46951041-46951063 CTGTCTTCATGTAATGAAATTGG + Intergenic
1108242837 13:48484891-48484913 CTCTGTTGATGTAATAAAGGGGG + Intergenic
1108484903 13:50913661-50913683 GTATATTCATGAAATAAAGGGGG - Intronic
1109921865 13:69074454-69074476 CTGTATTCTTATAATAAACTAGG + Intergenic
1111256352 13:85674468-85674490 CTTTAATTATGTAATAAAATTGG - Intergenic
1116156032 14:41207103-41207125 CTAAATGCATGTAATAAAGTTGG - Intergenic
1117090235 14:52242990-52243012 CTTTATCCATGAAATAAAGAGGG + Intergenic
1117189577 14:53277127-53277149 CTGAGTTCATGTAGTAAAGCTGG - Intergenic
1118118747 14:62811527-62811549 CTGTATTCATGGTAGAAAGAAGG - Intronic
1118829545 14:69417370-69417392 CTGTAGCCTTGTAATATAGTTGG + Intronic
1118881562 14:69830798-69830820 AGGTATACATGAAATAAAGTTGG - Intergenic
1120192680 14:81453422-81453444 ATGTATTCAGGTAATGAACTAGG - Intergenic
1120406123 14:84095449-84095471 CTATATTCTTGTTATGAAGTTGG - Intergenic
1121044063 14:90775145-90775167 ATGTATTCATGGAAAAAAGCCGG + Intronic
1122027854 14:98890590-98890612 TTTTATTGATGTCATAAAGTAGG + Intergenic
1125288096 15:38115851-38115873 CTGGATTCATGCAGTAAATTGGG + Intergenic
1126838305 15:52690430-52690452 CCTTATTCATGTAATATATTCGG - Intronic
1127101834 15:55573825-55573847 CTGTGTTCTTACAATAAAGTAGG + Intronic
1127717250 15:61661149-61661171 CTTTCTTCATGAAATAAAATGGG + Intergenic
1127897167 15:63311542-63311564 CTTTATTAATTTAATAATGTAGG - Intergenic
1130901685 15:88212011-88212033 TTTGATTCATGTAATAAATTGGG - Intronic
1131898216 15:97057524-97057546 CTGTGTTCATGTAGGAAAGGTGG - Intergenic
1140125258 16:72112941-72112963 CTTAAATCATGTAATAAAGGTGG + Intronic
1140197589 16:72868194-72868216 CTATATTCATTTACAAAAGTGGG + Intronic
1141073760 16:80983120-80983142 TTGTATTCATGCAATAAAGTAGG - Intronic
1144268547 17:13595134-13595156 CTGAATTTCTGTAATACAGTCGG + Intronic
1144353159 17:14418716-14418738 CTATATTCTTACAATAAAGTAGG - Intergenic
1150177834 17:63080543-63080565 ATGTATTAATCAAATAAAGTTGG - Intronic
1150200897 17:63356284-63356306 ACGTATTCCTTTAATAAAGTTGG + Intronic
1150454579 17:65296683-65296705 TAGTATTCATGGAATATAGTTGG + Intergenic
1150939618 17:69676562-69676584 ATTTATTCATTTAATAAACTGGG + Intergenic
1152936316 17:83139433-83139455 CTGTATTCATAAAATAAAGTGGG - Intergenic
1153894594 18:9546826-9546848 CTGTATTAATGATTTAAAGTGGG - Exonic
1155856588 18:30842252-30842274 CTGTATTACTGTAATAGTGTTGG - Intergenic
1155966589 18:32041316-32041338 GTGAATTCATGTAATACTGTTGG + Intronic
1156800278 18:41103534-41103556 CTGAATTCATTTTATAAAGATGG + Intergenic
1157991262 18:52499273-52499295 CTGTAATCATTTAACAAACTGGG - Intronic
1159268244 18:66112269-66112291 GTGTATTCTTACAATAAAGTAGG - Intergenic
1160119613 18:76118238-76118260 CTGAATTTCTGTAATAAATTAGG + Intergenic
1161988804 19:7672254-7672276 CTGTTTTCATGGAAGACAGTTGG + Intergenic
1162260470 19:9529738-9529760 CTGAATGCATGTAATAAAAATGG - Intronic
1162265166 19:9567210-9567232 CTGTATGCATGTAATGAAAATGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164723452 19:30449636-30449658 CTCTGTTCATTAAATAAAGTCGG + Intronic
927615972 2:24596298-24596320 CTGTGTTCATTTAATAATATCGG + Intronic
928572810 2:32626118-32626140 GTGAATTCCAGTAATAAAGTAGG - Intergenic
928981606 2:37141497-37141519 TTGTATTTAAGCAATAAAGTTGG - Intronic
929625670 2:43404138-43404160 CTGTACTCTTGTAATGAAGAGGG + Intronic
936393740 2:112101603-112101625 CTGTATTCTTACAATAAAGTAGG + Intronic
937874680 2:126813906-126813928 CTGTTTTCATAGAATCAAGTAGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939286918 2:140143724-140143746 TTGTATTCATATACTAAAATGGG + Intergenic
940952476 2:159691421-159691443 CTGTATTCTTACAATAAAGTAGG + Intergenic
941054647 2:160773139-160773161 CTTGATTCATGTGATAAAATGGG + Intergenic
941447367 2:165618501-165618523 CTCTATGCATTTCATAAAGTTGG + Intronic
942361260 2:175174147-175174169 CTGTATTCTTACAATAAAGGTGG + Intergenic
942740536 2:179171708-179171730 CTGTGTTCATGTATTAAAACTGG + Intronic
943520245 2:188940448-188940470 CTGTCTACATTAAATAAAGTGGG - Intergenic
943956909 2:194203697-194203719 CTGTATACATCTAATCAAGGAGG - Intergenic
945366053 2:208955745-208955767 ATGTATTCATTTAATAAAACTGG - Intergenic
946815185 2:223569875-223569897 CTGTATTCAAGTATTCAAATAGG + Intergenic
946979647 2:225195343-225195365 CTCTAATAATGTAATGAAGTAGG + Intergenic
947339262 2:229120329-229120351 CTATATTCTTGCAATAAAATAGG + Intronic
948228952 2:236335713-236335735 CTGTGTTAATGGAATAAGGTAGG - Intronic
1169694874 20:8376111-8376133 CAGTTTTCATGTACTAAAGTTGG - Intronic
1169818112 20:9679798-9679820 ATGTCTTCATGTAATAAACAGGG + Intronic
1174059549 20:47822916-47822938 CTGTATTCCTACAATAAAGTCGG - Intergenic
1174672065 20:52317862-52317884 CAGTAGCCATGTAATAAATTGGG - Intergenic
1175048674 20:56132252-56132274 TTTTATTCATGTAATAAGGATGG - Intergenic
1176729064 21:10472019-10472041 CTGTAGTCTTTCAATAAAGTGGG + Intergenic
1177747164 21:25231233-25231255 CTATATTCATGTAATAAGAAAGG + Intergenic
1178174620 21:30082158-30082180 CTGTATTTATCTAGTAAATTGGG - Intergenic
1178550971 21:33539150-33539172 CGGTAATCATGTTTTAAAGTGGG - Exonic
1178929778 21:36807263-36807285 CTTTATTCATGGAATAAACCTGG + Intronic
1180377413 22:12107209-12107231 CTGTAGCCTTGTAATATAGTTGG + Intergenic
1182277345 22:29198968-29198990 CTGTATTCTCACAATAAAGTAGG + Intergenic
1182571488 22:31242394-31242416 ATGTATTCATGAAATAAAAATGG - Intronic
950204616 3:11069319-11069341 ATGTTTAAATGTAATAAAGTAGG + Intergenic
951568041 3:24031752-24031774 CTGTATTCTTACAATAAAGTAGG + Intergenic
952097130 3:29967197-29967219 CTGTCTTCATGGAATGAATTAGG + Intronic
952161094 3:30693959-30693981 CTGTACTCATGTATTAAAATAGG + Exonic
954778172 3:53038528-53038550 CTGTATTAATGTAGTAAATGTGG - Intronic
955675488 3:61443792-61443814 ATGTAGTCCTGTTATAAAGTGGG - Intergenic
955827698 3:62965659-62965681 GTGTATTAATGAAATAAAGTAGG - Intergenic
956383545 3:68691926-68691948 CGCTATTCATTTAATAATGTAGG + Intergenic
958156016 3:89756780-89756802 CTGTAGTCTTGTAGTATAGTTGG - Intergenic
958469969 3:94504429-94504451 CTGTCTTCATATAATAAAGTTGG + Intergenic
958827773 3:99052649-99052671 ATGTATGCATGTAATGAAGAAGG - Intergenic
959033040 3:101324871-101324893 CTGAATTCATGTGATAATGGTGG - Exonic
963565956 3:146931031-146931053 CTGTATTCATGTAGGAAATCAGG + Intergenic
963768542 3:149364779-149364801 CTGTACACATGTAACAAAGAGGG + Intergenic
964591902 3:158374070-158374092 CTATGTGCATATAATAAAGTTGG - Intronic
966182479 3:177199157-177199179 CTATTTTCATGTATGAAAGTGGG + Intergenic
967033435 3:185629694-185629716 GTGTAATCATGTAATAAAGCAGG - Intronic
967800143 3:193648411-193648433 GTGTATTCCTGTAATTTAGTGGG + Intronic
969747508 4:9085266-9085288 CTGTAGCCTTGTAATATAGTTGG - Intergenic
970000570 4:11361670-11361692 TTGTATTCTTATAATAAAATAGG - Intergenic
971025247 4:22582980-22583002 CTGTATTCTTACAATAAATTAGG - Intergenic
972024042 4:34353979-34354001 CTTTATTCATATAAAAATGTTGG - Intergenic
972690522 4:41393134-41393156 CTGTAGTCATATCACAAAGTTGG - Intronic
973023615 4:45236642-45236664 CTGTTTTCTTGTTATAAAGATGG + Intergenic
974915122 4:68170082-68170104 TTGTATTCATGTACAAATGTAGG + Intergenic
975279972 4:72550502-72550524 CTGTATTCATTTAGTAAAATGGG - Intronic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
975868845 4:78755750-78755772 ATTTTTTAATGTAATAAAGTAGG - Intergenic
975899264 4:79131010-79131032 CTGTCTTCATAAAATAAATTTGG + Intergenic
976807637 4:89065949-89065971 ATTTGTTCATGTATTAAAGTGGG - Intronic
976920042 4:90428509-90428531 CTGTATTCTTATAATAAAGTAGG + Intronic
977147664 4:93465594-93465616 CTGTATTCATGACACAAAGTCGG + Intronic
977210566 4:94213082-94213104 CTTTATTCATAAAATATAGTAGG - Intronic
978174375 4:105711105-105711127 CTATATTATTGTAATAAAATAGG + Intronic
979062802 4:116086378-116086400 CTTAATTCAAGAAATAAAGTAGG + Intergenic
979549024 4:121969506-121969528 CTTTATTCAAGTAATACATTTGG + Intergenic
979601421 4:122590310-122590332 CTATATTCTCATAATAAAGTAGG - Intergenic
980656764 4:135797973-135797995 CCGTTTTCATGTCTTAAAGTTGG - Intergenic
981870744 4:149482782-149482804 CTGTCTTCATATAATAAATTTGG + Intergenic
983609344 4:169625666-169625688 CTGTTTTCAGTTAATCAAGTTGG + Intronic
984472734 4:180197060-180197082 CTGTATACCTGTAAGAAAGATGG + Intergenic
984994117 4:185411563-185411585 GTGCATTCATGAAATAAACTCGG - Intronic
1202759021 4_GL000008v2_random:92668-92690 CTGTAGCCTTGTAATATAGTTGG + Intergenic
985715840 5:1460658-1460680 CAGTATTCATGTATTAAAAATGG + Intronic
987664452 5:20919123-20919145 CTGTATTCTCACAATAAAGTAGG + Intergenic
987801988 5:22710158-22710180 CTGTACTTAGGAAATAAAGTTGG - Intronic
988234952 5:28530264-28530286 CTGACCTTATGTAATAAAGTAGG - Intergenic
988388644 5:30598842-30598864 CTATATTCAAGTATTAGAGTGGG - Intergenic
988697275 5:33635025-33635047 CTGTATTGATGTATTATATTAGG + Intronic
988758231 5:34283070-34283092 CTGTATTCTCACAATAAAGTAGG - Intergenic
989352907 5:40507927-40507949 CTATAATCATGGAATAAATTGGG + Intergenic
991908997 5:71542835-71542857 CTGTATTCTTATGATAAAATGGG + Intronic
993248356 5:85481961-85481983 GTTTATTCATATAAAAAAGTAGG - Intergenic
993886731 5:93423495-93423517 CTGTATTCAGGAAATAATGCTGG - Intergenic
998323797 5:141260137-141260159 CTTTATGCATGTAAGAAAGATGG + Intergenic
999081223 5:148845443-148845465 CAGTATGCATTTAATAAAATTGG + Intergenic
999928080 5:156401387-156401409 CTGTATTCATTCAACAAGGTAGG + Intronic
1000051129 5:157563745-157563767 CTGGATTCATGTAATGGAGGAGG - Intronic
1004220714 6:13743781-13743803 CTGTATTTAGGTAATCTAGTGGG + Intergenic
1005122564 6:22405889-22405911 CTGTATTCTTACAATAAAGTAGG + Intergenic
1005702933 6:28421416-28421438 CTTTCTTCATTTAATAAAGCTGG - Intergenic
1007064785 6:38978869-38978891 CTGTATTAATCAAATTAAGTAGG + Intronic
1008122038 6:47629903-47629925 CTGGATTCATAAAATAAATTGGG - Intergenic
1008348707 6:50461992-50462014 TTATAATCATGTAATTAAGTAGG + Intergenic
1008709766 6:54210931-54210953 TTATTTTTATGTAATAAAGTTGG + Intronic
1009370639 6:62896890-62896912 CTATAATCATGTAATAAAAGTGG - Intergenic
1009622151 6:66091369-66091391 GTGTATTGTTTTAATAAAGTGGG - Intergenic
1010767037 6:79787552-79787574 ATGTATACATTTTATAAAGTAGG + Intergenic
1011021169 6:82814528-82814550 ATTTATTCATGTAATAGAGCTGG + Intergenic
1011570761 6:88731897-88731919 CTATATTCTTAAAATAAAGTAGG + Intronic
1012368645 6:98475484-98475506 CTATATCTATGTAATACAGTTGG - Intergenic
1013500088 6:110740579-110740601 TTGTAATCATGGAATAAACTTGG - Intronic
1014954888 6:127602428-127602450 CTGTCTTCAAGTAATAATGAAGG - Intergenic
1016573318 6:145539316-145539338 CTGTTTATATGTAATAAGGTAGG + Intronic
1016725331 6:147358696-147358718 CTGTATTCATGTAATAAAGTAGG + Intronic
1018602706 6:165562361-165562383 TTGTTTTCATGTAAAATAGTTGG - Intronic
1019036483 6:169064176-169064198 CTGTATTCAAGGTATAAAGTTGG + Intergenic
1022449131 7:30498127-30498149 ATGTAGACATGTATTAAAGTAGG - Intronic
1023046765 7:36216844-36216866 ATGTATACATTTAATAAAATGGG - Intronic
1024394177 7:48847289-48847311 CTGTTTTCATGCAGTAAAGAAGG - Intergenic
1024401060 7:48925125-48925147 CTGTTTTCATGCAGTAAAGAAGG + Intergenic
1025235357 7:57231076-57231098 TTGTATTCCTATAATAAAGTCGG + Intergenic
1026495509 7:70898301-70898323 CTATATAAATGTAATAATGTGGG + Intergenic
1028412141 7:90541439-90541461 CTGTTTTCATGGAATGAATTTGG - Intronic
1030281486 7:107780277-107780299 CTGTATGCATTTAACATAGTAGG - Intronic
1030376692 7:108760752-108760774 CTGTAGCCCTGTAATATAGTTGG - Intergenic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031661329 7:124428668-124428690 CAGTACTCATGTAACAAAGAAGG + Intergenic
1033201076 7:139370839-139370861 CTGAGTTCACGTAATAATGTGGG - Intronic
1034600525 7:152249577-152249599 CTGTAGTCTTTCAATAAAGTGGG - Intronic
1035202338 7:157275722-157275744 CTGTATTCTTACAATAAAGTGGG - Intergenic
1036657895 8:10689723-10689745 CTGTGTTCTTACAATAAAGTAGG + Intronic
1039733858 8:40308652-40308674 CTGTATTCTTACATTAAAGTAGG - Intergenic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1040927742 8:52702163-52702185 ATGTGGTCATGTAATAAAGCTGG + Intronic
1041547745 8:59065142-59065164 CTGTATTTATTTAAAACAGTTGG + Intronic
1043949622 8:86293060-86293082 GTGTATTCTTACAATAAAGTGGG + Intronic
1044034278 8:87279487-87279509 CTGTATCCTTCTAATAAGGTGGG - Intronic
1045438873 8:102190566-102190588 CTGTTTTCATGAATTAGAGTTGG + Intergenic
1046406706 8:113781954-113781976 CTGTAGTCATGGAAGCAAGTAGG + Intergenic
1046902879 8:119541667-119541689 CTGGATTCATTTGACAAAGTGGG + Intergenic
1047039142 8:120973492-120973514 CTTAATTCATTTAAAAAAGTGGG + Intergenic
1048736442 8:137507248-137507270 TTATATTCATGTTATATAGTTGG - Intergenic
1051751382 9:20345711-20345733 CTGTATCCATGTAATGATCTTGG - Exonic
1055490956 9:76804919-76804941 CTGTCTTCATTTAATAAAATGGG + Intronic
1057610793 9:96541825-96541847 CTGTTTTCATGCAGTAAAGAAGG - Exonic
1060055481 9:120409365-120409387 CTGTATTTATATAATAAGGTTGG - Intronic
1203539804 Un_KI270743v1:77567-77589 CTGTAGCCTTGTAATATAGTTGG + Intergenic
1203585188 Un_KI270746v1:62055-62077 CTGTAGTCTTTCAATAAAGTGGG - Intergenic
1186053581 X:5626065-5626087 CTGTTTTCATGTAAAAAGGCAGG + Intergenic
1186186218 X:7022317-7022339 CTGGATTCATGAAATAGAGCTGG + Intergenic
1186645419 X:11501694-11501716 CCGTATTCTTACAATAAAGTAGG + Intronic
1186847572 X:13545662-13545684 CTGTTTTCATGCAATATTGTTGG - Intergenic
1187566002 X:20450210-20450232 CTATATATATATAATAAAGTTGG + Intergenic
1188536871 X:31206539-31206561 CTGTATTCTTTTATTAATGTTGG - Intronic
1191031094 X:55972959-55972981 CTGTATTCTTGTAGTACAGTTGG - Intergenic
1191159226 X:57310522-57310544 GGGTATTCTTTTAATAAAGTTGG + Intronic
1191244772 X:58218242-58218264 GTGTATTCATCTAACAAAATGGG + Intergenic
1193103347 X:77640560-77640582 CTGTAATCAAGTAGAAAAGTAGG + Intronic
1193250777 X:79288695-79288717 CTGTAGTGATGAGATAAAGTGGG - Intergenic
1193368451 X:80663141-80663163 CTGGTGTCATGTAATTAAGTTGG + Intergenic
1194320243 X:92437670-92437692 CTGTTTCCATGTAAAACAGTGGG - Intronic
1194610645 X:96039009-96039031 ATGTATTCATCTCAAAAAGTGGG + Intergenic
1194685040 X:96903279-96903301 CTTTATTCATGACATAAACTTGG + Intronic
1194696577 X:97059641-97059663 CTGTATTCTTACAATAAAGTAGG + Intronic
1195548821 X:106143339-106143361 CTGTAGCCCTGTAATATAGTTGG - Intergenic
1198639223 X:138738166-138738188 GTTTATTCATGTAATTAACTGGG - Intronic
1199614545 X:149646562-149646584 TTGCATTCATGTAATTAAGGTGG - Intergenic
1199952788 X:152718724-152718746 CTGCAGTCATGTAATTAAGGTGG + Intergenic
1199956895 X:152749724-152749746 CTGCAGTCATGTAATTAAGGTGG - Intergenic
1200628364 Y:5550800-5550822 CTGTTTCCATGTAAAACAGTGGG - Intronic
1200957305 Y:8963408-8963430 CTGTATTCAAGATTTAAAGTTGG - Intergenic