ID: 1016738013

View in Genome Browser
Species Human (GRCh38)
Location 6:147501288-147501310
Sequence CCCGGGGCTCCTGTATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016738001_1016738013 14 Left 1016738001 6:147501251-147501273 CCAGCTCAGAAGTCTGAGCCTCT No data
Right 1016738013 6:147501288-147501310 CCCGGGGCTCCTGTATGTCCAGG No data
1016737999_1016738013 26 Left 1016737999 6:147501239-147501261 CCAGTCAGCAGCCCAGCTCAGAA No data
Right 1016738013 6:147501288-147501310 CCCGGGGCTCCTGTATGTCCAGG No data
1016737998_1016738013 30 Left 1016737998 6:147501235-147501257 CCAGCCAGTCAGCAGCCCAGCTC No data
Right 1016738013 6:147501288-147501310 CCCGGGGCTCCTGTATGTCCAGG No data
1016738006_1016738013 -4 Left 1016738006 6:147501269-147501291 CCTCTGCTCTGTGGGGGCCCCCG No data
Right 1016738013 6:147501288-147501310 CCCGGGGCTCCTGTATGTCCAGG No data
1016738000_1016738013 15 Left 1016738000 6:147501250-147501272 CCCAGCTCAGAAGTCTGAGCCTC No data
Right 1016738013 6:147501288-147501310 CCCGGGGCTCCTGTATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016738013 Original CRISPR CCCGGGGCTCCTGTATGTCC AGG Intergenic
No off target data available for this crispr