ID: 1016738552

View in Genome Browser
Species Human (GRCh38)
Location 6:147506825-147506847
Sequence GCGGCGGCCCGCGCGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016738544_1016738552 -4 Left 1016738544 6:147506806-147506828 CCGCTTTGGCGAGGGAGAGGCGG No data
Right 1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016738552 Original CRISPR GCGGCGGCCCGCGCGGGGCG GGG Intergenic
No off target data available for this crispr