ID: 1016738863

View in Genome Browser
Species Human (GRCh38)
Location 6:147508165-147508187
Sequence CCGCAGCGTCCCCAGCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016738859_1016738863 0 Left 1016738859 6:147508142-147508164 CCGGAAGGAAGGGACACTGAACC No data
Right 1016738863 6:147508165-147508187 CCGCAGCGTCCCCAGCGCCGTGG No data
1016738853_1016738863 27 Left 1016738853 6:147508115-147508137 CCGAGGAAGGGGGATTCAAACGC No data
Right 1016738863 6:147508165-147508187 CCGCAGCGTCCCCAGCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016738863 Original CRISPR CCGCAGCGTCCCCAGCGCCG TGG Intergenic
No off target data available for this crispr