ID: 1016739090

View in Genome Browser
Species Human (GRCh38)
Location 6:147509194-147509216
Sequence CCGTCCCCACCGGCCGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016739075_1016739090 5 Left 1016739075 6:147509166-147509188 CCGGCGCCCCCCGGGCCGCCCGC 0: 1
1: 1
2: 30
3: 154
4: 1089
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739078_1016739090 -3 Left 1016739078 6:147509174-147509196 CCCCGGGCCGCCCGCCGACGCCG 0: 1
1: 1
2: 6
3: 51
4: 385
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739076_1016739090 -1 Left 1016739076 6:147509172-147509194 CCCCCCGGGCCGCCCGCCGACGC 0: 1
1: 0
2: 5
3: 30
4: 371
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739070_1016739090 30 Left 1016739070 6:147509141-147509163 CCTCTACTTCACGCTTGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739074_1016739090 11 Left 1016739074 6:147509160-147509182 CCGCAGCCGGCGCCCCCCGGGCC 0: 1
1: 0
2: 3
3: 88
4: 686
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739081_1016739090 -10 Left 1016739081 6:147509181-147509203 CCGCCCGCCGACGCCGTCCCCAC 0: 1
1: 0
2: 0
3: 34
4: 454
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739079_1016739090 -4 Left 1016739079 6:147509175-147509197 CCCGGGCCGCCCGCCGACGCCGT 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739080_1016739090 -5 Left 1016739080 6:147509176-147509198 CCGGGCCGCCCGCCGACGCCGTC 0: 1
1: 0
2: 3
3: 35
4: 222
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123
1016739077_1016739090 -2 Left 1016739077 6:147509173-147509195 CCCCCGGGCCGCCCGCCGACGCC 0: 1
1: 1
2: 4
3: 53
4: 386
Right 1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016739090 Original CRISPR CCGTCCCCACCGGCCGCCGG GGG Exonic
900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG + Intronic
900384475 1:2403491-2403513 CCTTCCCCAGCAGCCGCAGGTGG + Exonic
900786269 1:4652776-4652798 CCTTCCCCGCCGGCCGCCATAGG + Intergenic
901433933 1:9234856-9234878 CCTTCCCCTGCGGCCGCCGCGGG + Exonic
902476876 1:16693061-16693083 CCTTGCTCACCGGCAGCCGGGGG + Intergenic
903455486 1:23484198-23484220 CCGGCCTCACCGCCGGCCGGGGG + Intronic
915345547 1:155195181-155195203 CCGTCCCTCCCGCCCGCCCGGGG - Intergenic
920409668 1:205749648-205749670 CCTCCCCCTCCGGCCGCTGGCGG + Intronic
922937847 1:229434778-229434800 GCGCGCCCTCCGGCCGCCGGTGG - Intergenic
922958531 1:229625752-229625774 CCACCCCCACCGCCCGCCGGCGG + Intronic
924941099 1:248812859-248812881 CCTTCCCCACCGCTAGCCGGAGG + Intronic
1062874069 10:931444-931466 CCCGCCCGACCGGCCGCCCGCGG + Exonic
1062939608 10:1411354-1411376 CCGTCCCCACCAGCCCAGGGCGG + Intronic
1065214768 10:23439142-23439164 GAGTCCCCAGCGGCCGCCGCGGG + Intergenic
1066013330 10:31214481-31214503 CCGTGCCCATGGGCAGCCGGAGG + Intergenic
1068580368 10:58732240-58732262 CCATCCCCACCCGCCGCCTTGGG - Intronic
1072811821 10:98468005-98468027 CCGACCCGACTGGCGGCCGGGGG - Intronic
1074137881 10:110643962-110643984 CCGTCCCCAGGGACAGCCGGAGG + Intergenic
1075275477 10:121089306-121089328 CCGTCCCCACCCGACCCAGGGGG + Intergenic
1076736853 10:132462818-132462840 CCGTGCCCACCGGCAGCAGGTGG - Intergenic
1076916683 10:133425894-133425916 CCCTCCCCGCCCGCAGCCGGAGG - Intergenic
1076936787 10:133570689-133570711 CCCTCCCCGCCCGCAGCCGGAGG - Intergenic
1077198194 11:1291845-1291867 CCGTCCTCACCGACCCCCGAGGG + Intronic
1077635953 11:3841248-3841270 CCGCCCCCACCAGCCTCCGCGGG + Intergenic
1079008778 11:16811542-16811564 CTGTCCCCACAGGCTGCAGGAGG + Intronic
1080540435 11:33258514-33258536 GCGTCCCCAGCGGCGGCGGGAGG + Intronic
1086337136 11:85811186-85811208 CCCACCGCACCGCCCGCCGGGGG - Intergenic
1090832351 11:130428257-130428279 CCGCCCCCGCCGCCCCCCGGTGG - Exonic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096389585 12:51218086-51218108 CCGCCCGCGCCAGCCGCCGGGGG + Intergenic
1097685027 12:62683260-62683282 CCTTCCCCACCGGCTTCTGGAGG - Intronic
1099989555 12:89708555-89708577 CCGCCGCCCCCGGCCGCGGGCGG + Intronic
1101874406 12:108589241-108589263 CCGACCCCACCTCCAGCCGGAGG - Intergenic
1103604858 12:122078965-122078987 CCGTCCCCGCCGCCCGCCTCCGG + Exonic
1103903352 12:124314894-124314916 CCGTCCCCACCGGCTGAGGCTGG - Exonic
1104916633 12:132268914-132268936 CCGTCCCCACCCGCCACACGTGG - Intronic
1106134284 13:26962467-26962489 CCGTCCCCACCCTCCGCTGGAGG - Intergenic
1106516944 13:30464650-30464672 CCGGCCCCGGCGGCCGCGGGCGG - Intronic
1112344366 13:98577320-98577342 CCGGCCCCGCCGCCCGCCCGCGG - Intronic
1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG + Intergenic
1115474484 14:33800381-33800403 CCGTCCCCGCAGGGCGGCGGCGG + Exonic
1120961463 14:90128891-90128913 CCGTCCCCACCGCCAACCTGAGG + Intronic
1122226840 14:100285402-100285424 CCGCCGCCGCCGGCCGCAGGAGG + Intergenic
1123630700 15:22258100-22258122 TCGTCGCCCCCGGCCGCCGCGGG + Intergenic
1125607840 15:40952430-40952452 CCGAGTCCACAGGCCGCCGGGGG - Intergenic
1127267911 15:57376340-57376362 TCGTCCCGACGGGCCGCGGGCGG + Intronic
1129694478 15:77732941-77732963 CCCTCCCCACCGGCCACGGCCGG + Intronic
1132810501 16:1794558-1794580 CCGTCTCCACCTGCCTCCAGAGG + Intronic
1132851529 16:2026977-2026999 CGCTGCCCACCGGCCGCCCGCGG - Exonic
1135822228 16:25693897-25693919 CCTTTCCCACCGTCTGCCGGTGG + Intronic
1136129553 16:28211491-28211513 CCTTCCCCACCGGGCCCCGAGGG + Exonic
1136913546 16:34162292-34162314 CCGGCCCCAACGGGAGCCGGCGG - Intergenic
1141637504 16:85322290-85322312 CCTTCCCCCCCGCCCGCCCGGGG - Intergenic
1141684306 16:85561672-85561694 CCGGCCCCAGCTGCCCCCGGAGG + Intergenic
1146646215 17:34579109-34579131 CGCTCCCCACCGGGCGCCGGAGG - Exonic
1147971021 17:44219183-44219205 CAGTTCTCCCCGGCCGCCGGAGG - Intronic
1148559536 17:48597951-48597973 CCGTAGCCACCGCCCGCCGGCGG + Exonic
1151551503 17:74825013-74825035 CCATCACCACCGGCAGCCAGGGG + Intronic
1151854495 17:76711067-76711089 CCGCCCCCTCCGGCCCCGGGAGG + Intergenic
1151930772 17:77230236-77230258 CCGTCCCCACAGGCCGGCCCGGG - Intergenic
1152834393 17:82519928-82519950 CCGGCCCCGCCGCCCGCGGGTGG - Exonic
1153688450 18:7568084-7568106 CCGTCCGCTCCGCCCGCCCGAGG - Intronic
1154416455 18:14178228-14178250 ACCTCCCCACCTGCCACCGGTGG - Intergenic
1160164039 18:76495082-76495104 CCGCGCCCACCGCCCGCCCGCGG + Intronic
1160876786 19:1300150-1300172 CCGGCCCCTCGGGCCTCCGGGGG - Exonic
1161802680 19:6424640-6424662 CCGCCCCCGCCGGCGGGCGGCGG + Exonic
1161991380 19:7686176-7686198 CCATCCCCACCGGCCACCGAGGG + Exonic
1163117198 19:15195839-15195861 CCGGCCCGACCGGTCGGCGGGGG - Intronic
1163321340 19:16576767-16576789 CCGGCCCCGCCAGCCGCTGGTGG + Exonic
1167105983 19:47430050-47430072 TCGTCCCCACCGCCCGCCCGGGG - Exonic
1167592830 19:50413723-50413745 ACATCCCCACCGCCCGCAGGTGG + Exonic
1167638308 19:50667567-50667589 CCGTCCCCAGCTGCAGCAGGAGG + Exonic
1202710891 1_KI270714v1_random:18887-18909 CCTTGCTCACCGGCAGCCGGGGG + Intergenic
926066297 2:9843211-9843233 CCGACCCCCCGTGCCGCCGGAGG + Intergenic
927751464 2:25673729-25673751 CCCCGCCCACCGGTCGCCGGCGG + Intergenic
932488800 2:72105243-72105265 ACGTCCACACCGGCCCTCGGAGG + Intergenic
938392487 2:130916458-130916480 GCGTCCCGACCGGCCGCAGCGGG - Intronic
941920837 2:170849274-170849296 CTGTCCCCACAGGCTGCCTGGGG + Exonic
946164915 2:217858018-217858040 CATTCCCCACCGGCCTCCTGTGG - Intronic
946966418 2:225042194-225042216 CCGTTCCCCCCGGGCGCCTGGGG + Intronic
947992302 2:234497155-234497177 CCCGCCCCGCCCGCCGCCGGGGG + Intergenic
948689045 2:239690707-239690729 CCGCCCCCCCGGGACGCCGGGGG - Intergenic
1169483522 20:6006512-6006534 CGGGCCCCACTGGCCGCCCGGGG - Exonic
1171810517 20:29742299-29742321 CCGGCCCCAACGGGAGCCGGCGG + Intergenic
1172118635 20:32585217-32585239 CCGCCTCCCCCGGCCGCCCGCGG - Intronic
1172408224 20:34704596-34704618 GCGGCCCCGGCGGCCGCCGGCGG - Intronic
1173704701 20:45101129-45101151 CCGCCGCCTCCGGCCGCCAGCGG - Intergenic
1173997783 20:47352728-47352750 CCTTACCTACCGGCCGGCGGGGG - Intronic
1175902753 20:62366585-62366607 CCCTCCCCACCGGCAGCAGGCGG + Intronic
1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG + Intronic
1176856873 21:13981034-13981056 ACCTCCCCACCTGCCACCGGTGG + Intergenic
1178680463 21:34669424-34669446 GGGTCCCCAGGGGCCGCCGGAGG + Exonic
1178915739 21:36704796-36704818 CCCTCCCCATCGGCCGCGGGAGG + Intronic
1180004087 21:45011994-45012016 CCGACCCCAGCTGCCGCAGGAGG + Intergenic
1183050547 22:35257625-35257647 CCGTCGCCACCCGCCGCCCTGGG + Intronic
1184086797 22:42270371-42270393 CCCTCCCCGCCCGCCCCCGGCGG - Intronic
1185312580 22:50164522-50164544 CACTCCCCACCGGACACCGGGGG + Intergenic
949970045 3:9396937-9396959 CCCTCCCCTCCCGCCGCAGGAGG + Intergenic
950072614 3:10164819-10164841 GCGTCCCCAGCGGCCACGGGCGG - Intergenic
962722270 3:138187244-138187266 CCGGCCCCACCTGCCGCTCGCGG - Intronic
963236681 3:142963400-142963422 CAGCCCCCGCCGGCCGCCGTCGG + Exonic
967859021 3:194137892-194137914 CCGCCCCCACCGGGACCCGGCGG + Exonic
968756097 4:2417384-2417406 GCGTCCCCGCCGCCCGCCTGGGG - Intronic
971019068 4:22516102-22516124 TCCTCCCCGCCCGCCGCCGGCGG + Intergenic
978385559 4:108172781-108172803 CCTTCCCCGCGGGCCGCAGGAGG - Intergenic
978749674 4:112232251-112232273 CCGCCACCTCCAGCCGCCGGGGG - Intronic
982564687 4:156971952-156971974 CCCGCCCCATCGGCCGCCTGCGG - Intergenic
982667034 4:158277721-158277743 CCGTCCCCTCCCGCAGCCTGAGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985645237 5:1081829-1081851 CCTTCCCCTCCGGCCACCAGTGG - Intronic
989812591 5:45695948-45695970 CCGGCCCCGCCGCCCCCCGGCGG + Exonic
992328261 5:75685340-75685362 CCATCCCCACCAGCCGCCGTCGG - Exonic
997472102 5:134122844-134122866 CTGTCCCCACCTGCAGCAGGAGG - Intronic
999062770 5:148653999-148654021 GCGTCCCCACCGGCACCCGTGGG + Intronic
1003377495 6:5593294-5593316 CCGCCCCCACCGGCCTCTGCTGG + Intronic
1006458517 6:34145030-34145052 CCGTGCCCTCCGGCCTCCTGGGG - Intronic
1007698304 6:43747746-43747768 CCGTCCCCACCTGTCGGGGGAGG + Intergenic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1019828327 7:3301605-3301627 CCGCCGCCACCGGCCGCCGAGGG - Exonic
1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG + Exonic
1028585593 7:92447989-92448011 CCGGCCCCTCCCGCCGGCGGAGG + Intronic
1029482667 7:100822658-100822680 CCGTGTCCACCTGCCGGCGGGGG + Exonic
1031899435 7:127392848-127392870 CCCTCCCCACCGGCCGCGGCGGG - Intronic
1032130704 7:129225203-129225225 GGGTCTCCACCGCCCGCCGGGGG - Exonic
1035203270 7:157279755-157279777 GGGTCCCCACCGGGGGCCGGAGG + Intergenic
1036123830 8:6045275-6045297 CTGGCCCCACCGGCCCCAGGCGG - Intergenic
1041689755 8:60678218-60678240 CAGTCACCCCCGGCCGCCGCCGG + Intergenic
1042155620 8:65841673-65841695 CCCTCCGCTCGGGCCGCCGGCGG + Exonic
1045047541 8:98293962-98293984 GCGTCCCCACCGGGCTGCGGTGG + Intronic
1045336036 8:101205350-101205372 CGGTCCCCACCGCCCCCCGCTGG + Intronic
1049624639 8:143614553-143614575 CCGGCCCCACCCGCCCCTGGGGG + Intronic
1049790353 8:144469568-144469590 CCGTCACCACCTGCTACCGGGGG + Exonic
1049835740 8:144734429-144734451 CCTGCCCCACCGGACGCTGGAGG + Intronic
1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG + Intronic
1061666162 9:132162022-132162044 GCGGCCCCCCCGGCGGCCGGAGG + Exonic
1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG + Intergenic
1199771181 X:150976241-150976263 CCCTCCCCACCAGACCCCGGAGG - Intergenic