ID: 1016739091

View in Genome Browser
Species Human (GRCh38)
Location 6:147509195-147509217
Sequence CGTCCCCACCGGCCGCCGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016739078_1016739091 -2 Left 1016739078 6:147509174-147509196 CCCCGGGCCGCCCGCCGACGCCG 0: 1
1: 1
2: 6
3: 51
4: 385
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739079_1016739091 -3 Left 1016739079 6:147509175-147509197 CCCGGGCCGCCCGCCGACGCCGT 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739074_1016739091 12 Left 1016739074 6:147509160-147509182 CCGCAGCCGGCGCCCCCCGGGCC 0: 1
1: 0
2: 3
3: 88
4: 686
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739080_1016739091 -4 Left 1016739080 6:147509176-147509198 CCGGGCCGCCCGCCGACGCCGTC 0: 1
1: 0
2: 3
3: 35
4: 222
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739081_1016739091 -9 Left 1016739081 6:147509181-147509203 CCGCCCGCCGACGCCGTCCCCAC 0: 1
1: 0
2: 0
3: 34
4: 454
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739077_1016739091 -1 Left 1016739077 6:147509173-147509195 CCCCCGGGCCGCCCGCCGACGCC 0: 1
1: 1
2: 4
3: 53
4: 386
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739075_1016739091 6 Left 1016739075 6:147509166-147509188 CCGGCGCCCCCCGGGCCGCCCGC 0: 1
1: 1
2: 30
3: 154
4: 1089
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1016739076_1016739091 0 Left 1016739076 6:147509172-147509194 CCCCCCGGGCCGCCCGCCGACGC 0: 1
1: 0
2: 5
3: 30
4: 371
Right 1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016739091 Original CRISPR CGTCCCCACCGGCCGCCGGG GGG Exonic
900641411 1:3689619-3689641 CGTCCCCACCGAGAGCCGGCAGG - Intronic
902476877 1:16693062-16693084 CTTGCTCACCGGCAGCCGGGGGG + Intergenic
903179212 1:21597056-21597078 CGTCCCCACCCCCAGCCTGGGGG - Exonic
904181371 1:28668907-28668929 CGCCCTCGCCGGCCGCCGCGCGG - Intronic
905740209 1:40363740-40363762 CTTCCCCACCAGCAGCCGTGTGG + Intronic
906193323 1:43913101-43913123 CCTCCCCACCGGGAGCCAGGGGG + Intronic
912401529 1:109397663-109397685 CGACGCCAACGGCCGCCGCGGGG + Exonic
922335863 1:224617562-224617584 CGTCCTCTCCTGCCGGCGGGAGG + Intronic
922958532 1:229625753-229625775 CACCCCCACCGCCCGCCGGCGGG + Intronic
1084499129 11:69524596-69524618 CGCCTCCTCCAGCCGCCGGGAGG - Intergenic
1084679758 11:70660017-70660039 CCTCCCCACAGGACCCCGGGAGG + Intronic
1090208071 11:124896659-124896681 CCTCCCCACAGTCCTCCGGGAGG - Exonic
1092281328 12:7099875-7099897 AGTCCCCACCTGCCGAGGGGTGG - Intronic
1095349195 12:41188900-41188922 CGGCCCCAGCGGCCGCCCGGCGG - Exonic
1096541199 12:52308280-52308302 CGTCCCCTCCTCCCGCTGGGCGG + Intronic
1096691003 12:53321682-53321704 CTCCCCCTCCGGCCGCCAGGGGG - Intronic
1099365229 12:81759279-81759301 CGTCCTCACCGGCTGCCAGCAGG - Exonic
1106539081 13:30674190-30674212 GGTGCCCAGCGGCCGCCGCGGGG + Intergenic
1113874427 13:113585222-113585244 GGTCCCCGCGGGCCGCCGTGGGG - Intronic
1114656057 14:24316299-24316321 CCGCCGCACCGGCCGCCTGGTGG + Exonic
1122904578 14:104795827-104795849 CGTCCCCACCGCGCGGCCGGCGG + Intergenic
1122978680 14:105181486-105181508 GGTCGACCCCGGCCGCCGGGCGG + Intergenic
1122993383 14:105249283-105249305 CGTCCGCCCCGTCCGCCGTGTGG + Intronic
1128075999 15:64825890-64825912 CGACACCACGCGCCGCCGGGTGG - Intergenic
1130076596 15:80695285-80695307 CGCCTCCTCCTGCCGCCGGGCGG + Exonic
1130261183 15:82355451-82355473 CGTCCCCTGCGGCCGCTCGGTGG + Intergenic
1130280052 15:82513567-82513589 CGTCCCCTGCGGCCGCTCGGTGG - Intergenic
1130471427 15:84229753-84229775 CGTCCCCTGCGGCCGCTCGGTGG - Intergenic
1130478921 15:84344324-84344346 CGTCCCCTGCGGCCGCTCGGTGG - Intergenic
1130492849 15:84443807-84443829 CGTCCCCTGCGGCCGCTCGGTGG + Intergenic
1130593721 15:85234380-85234402 CGTCCCCTGCGGCCGCTCGGTGG - Intergenic
1132557473 16:578956-578978 CCTCCCCACCGCCCCCTGGGAGG + Intronic
1132889304 16:2196252-2196274 CCTCCCCGCCCGGCGCCGGGTGG + Intronic
1133019480 16:2960871-2960893 CCTCCCCAGCGGCCTCCAGGGGG + Intergenic
1136129554 16:28211492-28211514 CTTCCCCACCGGGCCCCGAGGGG + Exonic
1136470137 16:30474241-30474263 TCTCCCCACCGCGCGCCGGGAGG + Exonic
1142741476 17:1934298-1934320 CGTCCCCACCAGCCGCCTGCCGG + Intergenic
1147263071 17:39219961-39219983 TGGCCCCACCAGCCTCCGGGAGG + Intronic
1148262243 17:46193559-46193581 CGCCCCCGCGGGCCGCCAGGAGG + Intronic
1148559537 17:48597952-48597974 CGTAGCCACCGCCCGCCGGCGGG + Exonic
1148936464 17:51167211-51167233 CCTGCCCACCCGCCGCAGGGGGG + Intronic
1149705623 17:58692057-58692079 AGCCCCCAACGGCCGCTGGGAGG - Intergenic
1152293381 17:79453385-79453407 CCTCCCCATCTGCCGCCAGGAGG - Intronic
1153815274 18:8785435-8785457 CCTCCCCAGCGGCGGCAGGGCGG - Intronic
1154174505 18:12076626-12076648 CGGCCCCGCCGGCGTCCGGGCGG + Intergenic
1154416453 18:14178227-14178249 CCTCCCCACCTGCCACCGGTGGG - Intergenic
1154503108 18:15006125-15006147 CGTCCCCACTGGCGGCCAAGGGG - Intergenic
1155096346 18:22559746-22559768 AGTCGCCCCCGGCCGCCCGGTGG - Intergenic
1159001477 18:62978945-62978967 CTTCACCAACGGCAGCCGGGTGG + Exonic
1160809997 19:1009164-1009186 CGTCCCCAGCGGCCCCGAGGTGG + Exonic
1160876785 19:1300149-1300171 CGGCCCCTCGGGCCTCCGGGGGG - Exonic
1160999847 19:1905190-1905212 CCTCCCCTCCCGCCGCCCGGAGG + Intergenic
1163347020 19:16749745-16749767 CGTCCCCAGCAGCCGCAGGACGG - Exonic
1163678930 19:18669522-18669544 AGTCCCCACGGGCTGGCGGGTGG + Exonic
1163830246 19:19544092-19544114 AGTCACCACCAGCCGCTGGGTGG - Exonic
1165469264 19:35994101-35994123 TGTCCCCGCGGGCCGCCTGGAGG - Intergenic
1165939854 19:39409694-39409716 CGTCCCCACGGGGCCGCGGGAGG + Intergenic
1167045947 19:47048644-47048666 CCGCCCCACCGGCCTCCGGTAGG + Intergenic
1202710892 1_KI270714v1_random:18888-18910 CTTGCTCACCGGCAGCCGGGGGG + Intergenic
929000760 2:37344985-37345007 CGACTCCTCCGGGCGCCGGGTGG - Intronic
929761494 2:44811080-44811102 CGCCCCCTCCCGCCCCCGGGTGG + Intergenic
932601126 2:73126685-73126707 CGTCCCCACCGGCCAGGAGGTGG + Intronic
932608079 2:73177489-73177511 CGTCCCCGCCCGCTGCCGGGAGG + Intergenic
934954825 2:98608643-98608665 CGACCCCAGCCGCCACCGGGCGG - Exonic
937353629 2:121184642-121184664 CTTCCCCACAGGCCTCCAGGTGG - Intergenic
937915044 2:127094843-127094865 CCTGCCCACCAGCCCCCGGGTGG + Intronic
938502277 2:131836295-131836317 CGTCCCCACTGGCGGCCAAGGGG - Intergenic
939629578 2:144516651-144516673 CGACCCCACCGGACCCCGCGCGG + Intronic
948689044 2:239690706-239690728 CGCCCCCCCGGGACGCCGGGGGG - Intergenic
948711773 2:239829584-239829606 CGTCCCCACCGCACCCCCGGAGG - Intergenic
949014466 2:241701785-241701807 CGGCCCCACCGCCCGGCGTGCGG - Intergenic
1172122529 20:32607417-32607439 GGGCCCCTCTGGCCGCCGGGTGG - Intronic
1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG + Intronic
1176856875 21:13981035-13981057 CCTCCCCACCTGCCACCGGTGGG + Intergenic
1179217534 21:39380503-39380525 CATCCCCACCGGCCCTTGGGAGG - Intronic
1179714227 21:43279630-43279652 CCTCCCCTCCGGCCCTCGGGCGG - Intergenic
1185315811 22:50178623-50178645 CTTCCCCACCTGCCTCCCGGGGG - Intronic
1203259846 22_KI270733v1_random:167552-167574 CTTCCCCGCCGCCCCCCGGGTGG - Intergenic
1203296437 22_KI270736v1_random:46953-46975 CACCCCCACCCGCCACCGGGCGG + Intergenic
950125207 3:10506265-10506287 CGACCCCACCTGCCCTCGGGGGG + Intronic
950282290 3:11719153-11719175 GGTCCCCGCCGGCCTCAGGGAGG - Intronic
954390942 3:50267642-50267664 GGTCCCCAGCGGCCCCAGGGTGG + Intronic
957085406 3:75672323-75672345 CGTGCCCACGGGCCGCCGCTTGG + Intergenic
962263148 3:133927631-133927653 CGGCCCCACAGCCAGCCGGGCGG - Intergenic
962793858 3:138834504-138834526 CGCCCCCACCGGCCGGTAGGCGG + Intronic
963607640 3:147424505-147424527 GGTCCCCAGCAGCCCCCGGGTGG - Intronic
965571950 3:170181753-170181775 CCTCTCCGCCCGCCGCCGGGGGG - Intergenic
971018962 4:22515756-22515778 CGGCCCCGCCGGCGTCCGGGTGG + Exonic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985727567 5:1524037-1524059 CGCCCCTGCCGGCCGGCGGGAGG - Intergenic
998583487 5:143403755-143403777 CGTTCCCCGCGGCCGCCGCGCGG - Intronic
1003074569 6:2971693-2971715 CGGCCCCTCCGGCTGGCGGGTGG - Intronic
1003188212 6:3850723-3850745 CTTCCCCGCCAGCCGCTGGGAGG + Exonic
1010043981 6:71420115-71420137 AGTCCCCACCGGCCGCGCTGCGG + Intergenic
1011762820 6:90586888-90586910 CGGCCCCACCGGGCGCCGCGAGG - Exonic
1014116844 6:117675869-117675891 CGTCACCACCGGCACCCGCGCGG + Exonic
1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG + Exonic
1020204529 7:6104868-6104890 CGCCCCTCCGGGCCGCCGGGGGG - Exonic
1022106390 7:27200315-27200337 CGTCCCCAGCGCCAGCCGCGCGG + Intergenic
1023838603 7:44082749-44082771 CGGCCCCATTGGCCTCCGGGAGG + Intergenic
1023861862 7:44221453-44221475 CCTCCTCCCCGGCCTCCGGGTGG - Intronic
1029117736 7:98245939-98245961 TGTCCCCATCCGCCGCCGAGAGG - Exonic
1029413715 7:100430427-100430449 CAGCCCCACCGGCCACCTGGGGG + Exonic
1029482668 7:100822659-100822681 CGTGTCCACCTGCCGGCGGGGGG + Exonic
1030033276 7:105388381-105388403 GGTCGCCACCGGCCGGCGGGCGG - Intronic
1032130703 7:129225202-129225224 GGTCTCCACCGCCCGCCGGGGGG - Exonic
1036633214 8:10529840-10529862 CGTCCCCACAGGCTGGGGGGTGG - Intronic
1036646346 8:10613032-10613054 CTTCCCCACTGGCTGCCGTGAGG + Exonic
1049801269 8:144518403-144518425 CGTTCCCTGCGGCCGGCGGGAGG + Intronic
1054798545 9:69325099-69325121 CGCACCCACCTGCCGCCTGGCGG - Intronic
1058618495 9:106860793-106860815 CCTCCCCACCGGGACCCGGGGGG - Intergenic
1060811661 9:126614048-126614070 CGGCCCCGCGGGCCGCGGGGGGG - Intergenic
1061587020 9:131575998-131576020 CTTCCCCAGGGGCCGCCGTGGGG + Intergenic
1061666163 9:132162023-132162045 CGGCCCCCCCGGCGGCCGGAGGG + Exonic
1061666165 9:132162027-132162049 GGAGCCCTCCGGCCGCCGGGGGG - Exonic
1062036848 9:134386259-134386281 CGGCCCCATCGGCCGCTGGCCGG - Intronic
1189002763 X:36963673-36963695 GGTCCCCGCGGGCCGCCGTGGGG + Intergenic
1190099707 X:47513263-47513285 CGTCACCACCGGCACCCGCGCGG - Intergenic
1192962548 X:76145502-76145524 CACCCCCACCGGCTGCCCGGTGG + Intergenic
1192962985 X:76149585-76149607 CACCCCCACCGGCTGCCCGGTGG - Intergenic
1200138349 X:153885663-153885685 CTCCCCCACAGGCCGCCGTGGGG - Intronic
1200244653 X:154516434-154516456 TGAACCCACCGGCCGCCGAGTGG + Intergenic