ID: 1016741200

View in Genome Browser
Species Human (GRCh38)
Location 6:147530742-147530764
Sequence AGTTGAGGAATTGCGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016741190_1016741200 21 Left 1016741190 6:147530698-147530720 CCGACTGAAAAGAAGAGAGCAAA 0: 1
1: 0
2: 3
3: 51
4: 607
Right 1016741200 6:147530742-147530764 AGTTGAGGAATTGCGGGACCAGG 0: 1
1: 0
2: 2
3: 13
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016741200 Original CRISPR AGTTGAGGAATTGCGGGACC AGG Intronic
915562759 1:156697033-156697055 AGTTCAGGATTTGCAAGACCGGG + Intergenic
915946150 1:160153132-160153154 AGTAGAGGCATTGAGGGACAGGG - Intronic
916091348 1:161309942-161309964 GGTTGAGAAAGTGGGGGACCAGG + Exonic
919706677 1:200682935-200682957 AGTTGAAGAATTGCTGAAGCAGG + Intergenic
922165546 1:223112893-223112915 TGTTGAGGACCTGGGGGACCTGG + Exonic
924359154 1:243217953-243217975 AATGGAGGAATTTCGGGAGCTGG - Intronic
1070059584 10:72968820-72968842 AGGTGAGCAATTGCAGTACCTGG - Intergenic
1070541451 10:77418249-77418271 AGTTGAGGCTTTGCAGGGCCAGG - Intronic
1074059760 10:109954273-109954295 AGTTCATCAATTGCTGGACCAGG - Intergenic
1078106337 11:8360331-8360353 AGATGAGGAAGTGCAGGCCCGGG - Intergenic
1079042009 11:17067751-17067773 ACCTGAGGAATTCCGAGACCAGG - Intergenic
1080436836 11:32252751-32252773 AGATTAGGAATTCCTGGACCAGG + Intergenic
1084953881 11:72681156-72681178 AGCTGAGGAGATTCGGGACCTGG + Intergenic
1091578534 12:1763685-1763707 AGTCCAGGAATGGCTGGACCTGG + Intronic
1094392292 12:29964615-29964637 TGTAGAGGAACTGAGGGACCAGG + Intergenic
1106924429 13:34599358-34599380 AGTTGGAAAATTGTGGGACCAGG - Intergenic
1107482091 13:40793642-40793664 AGTTGAGGAATAGAGAGAACTGG - Intronic
1114049220 14:18907175-18907197 AGTTGAGGAATTGAGGAACAAGG + Intergenic
1114113344 14:19494756-19494778 AGTTGAGGAATTGAGGAACAAGG - Intergenic
1114115047 14:19612510-19612532 AGTTGAGGAATTGAGGAACAAGG - Intergenic
1114373192 14:22112817-22112839 AGTTGAGGAATTGCAGTACGTGG - Intergenic
1116899260 14:50346276-50346298 AGTTGGGACATTGCTGGACCAGG + Intronic
1130362634 15:83206071-83206093 AGGCCAGGAATTGGGGGACCTGG - Intronic
1132335961 15:101048899-101048921 AGCTGAGGACTTGAGGGACGTGG + Intronic
1133019661 16:2961758-2961780 AGGTGAGAAGTTGGGGGACCTGG - Intergenic
1134613601 16:15631167-15631189 ACTTGAGTTATTGTGGGACCAGG - Intronic
1142666880 17:1468338-1468360 AGTGGAGGCAATGGGGGACCAGG + Intronic
1144819187 17:18059470-18059492 AGCTCAGGAAATGAGGGACCGGG + Intronic
1146240972 17:31225415-31225437 AGTTGAGGAACTGAGGAACAAGG - Intronic
1148012412 17:44493979-44494001 AGTTAAGGAACTGAGGCACCAGG - Intronic
1148161726 17:45453994-45454016 AGCTGAGGACTGGCTGGACCGGG - Exonic
1150392961 17:64800639-64800661 AGCTGAGGACTGGCTGGACCTGG - Intergenic
1150444866 17:65221047-65221069 AGGTGGGGAATTGTGGGAACGGG + Intronic
1153649646 18:7228871-7228893 ATGTGGGGAATTGCAGGACCTGG - Intergenic
1162937091 19:13986760-13986782 AGATGGGGAAGTGCGGGGCCCGG - Intronic
1162954985 19:14092481-14092503 ATTTGAGGAATGGGGGGACATGG + Exonic
1165681305 19:37778706-37778728 TTTTGAGGAATAGCAGGACCAGG + Intronic
1166188873 19:41162035-41162057 GGTTTAGGAATTGCGGGAGCAGG - Intergenic
1166462487 19:43001388-43001410 TTTTGAGGAATTGAGGGGCCAGG + Intronic
929045790 2:37787681-37787703 AGTTGAGGAATTCTGAGTCCAGG - Intergenic
932623184 2:73278651-73278673 ACTTGAGGAATTGGGGGACTGGG + Intronic
934814515 2:97313554-97313576 AGTTGAGGAAGTGCCGGTCCAGG + Intergenic
934823178 2:97394929-97394951 AGTTGAGGAAGTGCCGGTCCAGG - Intergenic
938714051 2:134002573-134002595 AGTTCAGGAATTGGGTGACTAGG + Intergenic
946846960 2:223867953-223867975 AGATGAGGAATTAAGAGACCAGG + Intronic
1171418572 20:25000742-25000764 TGGTGTGGAATTGCTGGACCAGG + Intergenic
1173868500 20:46328082-46328104 AGGTGAGGGAATGCGGGGCCCGG + Intergenic
1174875455 20:54222562-54222584 AGTTTAGGATATGCGGGACTAGG + Intronic
1180467699 22:15629549-15629571 AGTTGAGGAATTGAGGAACAAGG + Intergenic
1180794389 22:18594971-18594993 AGTTGAGGATTTAGGGGAGCAGG + Intergenic
1181227351 22:21400349-21400371 AGTTGAGGATTTAGGGGAGCAGG - Intergenic
1181251299 22:21534490-21534512 AGTTGAGGATTTAGGGGAGCAGG + Intergenic
1182021813 22:27087909-27087931 AGTTGAGGAACTGAGGCACAGGG - Intergenic
951088217 3:18539705-18539727 AGTGGAGGAATTGCAGAAGCTGG + Intergenic
956214629 3:66835764-66835786 AGCTGAGGAACTGAGGGCCCCGG + Intergenic
960929107 3:122826179-122826201 AGTTGAGGAACCGGAGGACCTGG - Intronic
968058423 3:195710709-195710731 AGATGAGGTATGGAGGGACCTGG + Intergenic
968058459 3:195710934-195710956 AGATGAGGTATGGAGGGACCTGG + Intergenic
968058483 3:195711069-195711091 AGATGAGGTATGGAGGGACCTGG + Intergenic
968058499 3:195711159-195711181 AGATGAGGTATGGAGGGACCTGG + Intergenic
968058521 3:195711294-195711316 AGATGAGGTATGGAGGGACCTGG + Intergenic
968058552 3:195711460-195711482 AGATGAGGTATGGAGGGACCTGG + Intergenic
982126397 4:152187630-152187652 AATTAAGGAATTTCAGGACCTGG - Intergenic
982822163 4:159954766-159954788 AGAAGAGGAATTGCGGGAATGGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985330007 4:188821615-188821637 AGTGAAGGAACTGGGGGACCAGG + Intergenic
987093885 5:14531543-14531565 AGTGAAGGAATTGAGAGACCAGG + Intronic
998153540 5:139771238-139771260 GGGTGAGGAATTGCGGGCCTGGG + Intergenic
998174880 5:139895594-139895616 AGTTGAGAAATTGGGAGACTGGG - Intronic
1001813246 5:174646638-174646660 GGTTGAGGCACTGGGGGACCAGG + Intergenic
1002777473 6:341370-341392 AGTTGAGCAATAGAAGGACCAGG + Intronic
1002806324 6:578319-578341 ATGTGAGGAATTGCAGGCCCGGG + Intronic
1003240219 6:4338362-4338384 ATTAGAGGCATTGAGGGACCAGG + Intergenic
1004174307 6:13325927-13325949 AGTAGAGGAATTGAGGGTCAGGG - Intronic
1005873463 6:29994545-29994567 AGCTGAGGAGTTGCTGGAGCTGG - Intergenic
1007019351 6:38503779-38503801 AGTTGAGGAAATGAAGGACCTGG - Intronic
1016741200 6:147530742-147530764 AGTTGAGGAATTGCGGGACCAGG + Intronic
1017042705 6:150320424-150320446 AGTTGAGGAAGTGAGGTACATGG + Intergenic
1018046094 6:159968210-159968232 AGATGAGGAATTGAGGCACAAGG - Intergenic
1023095379 7:36654911-36654933 AGTTGAGGAATTTTGAGACTTGG - Intronic
1025177841 7:56810941-56810963 ACTGGAGGAAGTGCAGGACCTGG + Intergenic
1025181106 7:56824363-56824385 ACTGGAGGAAGTGCAGGACCTGG + Intronic
1025181536 7:56826105-56826127 ACTGGAGGAAGTGCAGGACCTGG + Intronic
1025693909 7:63765284-63765306 ACTGGAGGAAGTGCAGGACCTGG - Intergenic
1026269490 7:68823838-68823860 AGTTGAGGAATTGGAGAACCTGG - Intergenic
1029626439 7:101722852-101722874 AGATGAGCAATTGAGGGTCCTGG + Intergenic
1032863039 7:135899524-135899546 TGTTGAGGAATTGGGGAACCTGG - Intergenic
1034492848 7:151403266-151403288 ATTTGAGGAACTCGGGGACCAGG + Intronic
1037192670 8:16146229-16146251 AGGTGAGGAATTCAGGGACCAGG - Intronic
1041144135 8:54854223-54854245 AGTGGAGGAATTACAGTACCAGG + Intergenic
1045323367 8:101098550-101098572 AGTTGAGGAATAGCGGGAACTGG - Intergenic
1049218794 8:141419493-141419515 AGGTGGGGACTGGCGGGACCAGG + Intronic
1049815023 8:144595066-144595088 AGTTGTGGAATTGCTGGGTCAGG - Intronic
1051469974 9:17427141-17427163 ACTTCAGGAATTGTGGGAGCAGG - Intronic
1057623563 9:96657401-96657423 AGGTGAGGAATTGGGGGCACAGG - Intergenic
1058666701 9:107324924-107324946 AGTGGAGGAATTGCAGAAGCTGG + Exonic
1061539770 9:131271839-131271861 AGTTGAGGAATTGCGGGGGCCGG + Intronic
1062394242 9:136346325-136346347 AGCTGAGGACTTGGGGGCCCAGG - Intronic
1192185774 X:68946005-68946027 GGTTGAGGAATGGCGGCAGCCGG - Intergenic
1196509213 X:116486275-116486297 AGTAGAGGAATTGGGGGGCGGGG + Intergenic
1201890257 Y:18936001-18936023 AGTTGAGGATGTGCAGGACACGG - Intergenic