ID: 1016743018

View in Genome Browser
Species Human (GRCh38)
Location 6:147548304-147548326
Sequence CCTCAGAGAGACCATCATTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016743018 Original CRISPR CCTCAGAGAGACCATCATTT CGG Intronic
900050642 1:593560-593582 CCTCAGAGAAGCCATCAGCTAGG - Intergenic
902244989 1:15114927-15114949 CCTCAGAGTGACCGTCACTGTGG + Exonic
903425685 1:23252561-23252583 GCTGAGAGAGACCACCATCTAGG + Intergenic
905365175 1:37447483-37447505 TCTCAGAGAGACCATCACCTGGG + Intergenic
905935107 1:41817292-41817314 CATCAGACAGACAATAATTTGGG + Intronic
907630992 1:56081550-56081572 CCTCACAGTCACCTTCATTTTGG - Intergenic
909366965 1:74835724-74835746 CCTCAGAAAGAACCTCATTTTGG - Intergenic
913701774 1:121381271-121381293 GCTCAGTGAGAACATCAGTTGGG - Intronic
914042334 1:144061740-144061762 GCTCAGTGAGAACATCAGTTGGG - Intergenic
914135755 1:144898748-144898770 GCTCAGTGAGAACATCAGTTGGG + Intronic
916635997 1:166669148-166669170 CCTGAGATACTCCATCATTTTGG - Intergenic
917731642 1:177880782-177880804 TTTCAGAGACACCATCATGTAGG - Intergenic
918834566 1:189444966-189444988 ACACAGAAAGACCATCGTTTGGG - Intergenic
920489198 1:206399991-206400013 GCTCAGTGAGAACATCAGTTGGG - Intronic
920676582 1:208042419-208042441 CCTCAGTGAGACCCTCAGGTAGG - Intronic
921556590 1:216605721-216605743 CCTCAGAAAGCAAATCATTTTGG - Intronic
922344211 1:224682745-224682767 TCTGAGAGACACCTTCATTTAGG + Intronic
923086254 1:230705604-230705626 CCTCTGAGAGAGGACCATTTTGG - Intronic
1064248547 10:13689319-13689341 GCTCAGACACACCATGATTTGGG + Intronic
1069557181 10:69406213-69406235 CCTCAGTGAGACAATGATGTGGG - Intronic
1072697716 10:97616352-97616374 TCTCAAAGAGACCTTCATTGCGG + Exonic
1073134232 10:101211166-101211188 CCTCAGAGAGCTCATCCTTGTGG - Intergenic
1073705878 10:105983680-105983702 CCTCAGATTGACCAGGATTTGGG - Intergenic
1077545555 11:3167981-3168003 CCTCAGCATGACCAGCATTTGGG - Intergenic
1080689685 11:34546020-34546042 CCACAGAGCGGCCATCATTGAGG + Intergenic
1081466229 11:43320410-43320432 CCACAGAGAAGCCATCATTAGGG - Intronic
1083252690 11:61478423-61478445 CCTCAGAGAGCCCACGGTTTAGG - Intronic
1084371539 11:68748132-68748154 CCTTAGAGCCACCATCTTTTTGG - Intronic
1085974087 11:81630887-81630909 CCTCTAAGAGAACACCATTTAGG - Intergenic
1088699746 11:112401119-112401141 ACTCAGAGAGACTACCCTTTGGG + Intergenic
1091638817 12:2218590-2218612 CCACAGAGAGACCTTCCATTTGG - Intronic
1092980374 12:13788729-13788751 CCTCAGCAAAACAATCATTTTGG - Intronic
1093139911 12:15497461-15497483 AGTAAGAGAGAACATCATTTGGG - Intronic
1097306908 12:58079479-58079501 CCAGAGAGAGTCCATCATTTTGG + Intergenic
1101428154 12:104604674-104604696 CCTCAGTGATAACATCATTCCGG - Intronic
1103167996 12:118787089-118787111 TCTGGGAGAGACCATGATTTGGG + Intergenic
1109696925 13:65972732-65972754 GCTCAGCAAGACCAGCATTTTGG + Intergenic
1109967914 13:69725397-69725419 CCTTAAAGAGTCCATCTTTTAGG + Intronic
1111511682 13:89273116-89273138 CCTCAGAAATTCCATCATTGTGG + Intergenic
1112845239 13:103634685-103634707 TGTCAGAGAGACAATCATTACGG - Intergenic
1113796342 13:113060947-113060969 CCTCAGAGAGGCCACCGTGTGGG + Intronic
1113896665 13:113768794-113768816 CCCCAGAGACAACATCTTTTCGG - Intronic
1115462941 14:33682374-33682396 ACCCAAAGAGATCATCATTTAGG + Intronic
1115924760 14:38419321-38419343 CCCTAGAGAGACCATAATTCTGG + Intergenic
1118896225 14:69947991-69948013 CCTCAGTGAGATTACCATTTAGG - Intronic
1124199797 15:27669204-27669226 CCTCAGTGAAATTATCATTTTGG - Intergenic
1124338082 15:28872268-28872290 CCTCATAAACACCATCATATTGG - Intergenic
1125481047 15:40081056-40081078 CTCCAGAGTTACCATCATTTTGG + Intergenic
1126300704 15:47193001-47193023 GGTCTGAGAAACCATCATTTTGG + Intronic
1126459462 15:48899758-48899780 CCACAGAGAGTACACCATTTAGG + Intronic
1129260351 15:74363605-74363627 CGTCAGGGAGACCATTATTATGG - Intronic
1129659865 15:77547477-77547499 CCTCAGAGAGGCCAGTATTCAGG + Intergenic
1130239002 15:82168013-82168035 CCTGTGAGAGAACATCACTTTGG + Intronic
1132276484 15:100569396-100569418 CTTCAGAGACGACATCATTTGGG + Exonic
1134124415 16:11606623-11606645 CCTCAGAGATACTATGGTTTTGG - Intronic
1135275818 16:21111693-21111715 GCTCACAGAGATCATGATTTAGG + Exonic
1140577340 16:76186578-76186600 ACTGAGAGAGACCAGGATTTTGG + Intergenic
1140970450 16:80007483-80007505 CCTCAGAGTACCCATAATTTAGG + Intergenic
1141711011 16:85699023-85699045 CCTCAGTGAGGTCAGCATTTGGG - Intronic
1141804682 16:86334886-86334908 CCTGAGAAAGACCCTCACTTTGG + Intergenic
1143082972 17:4395098-4395120 CCTGAGAGATATCTTCATTTGGG - Intergenic
1143671045 17:8396487-8396509 GCCCAGAGAGGCCATCATTGGGG - Intronic
1143816528 17:9520021-9520043 CCTCACAGAGCTCATAATTTAGG - Intronic
1151125036 17:71835382-71835404 CCTCAGAAAGGCCCACATTTGGG - Intergenic
1157542886 18:48524746-48524768 GCTCAGAGAGCCCCTCATCTGGG + Intergenic
1157941122 18:51930131-51930153 CCTCATAGAGAACATCAGCTAGG + Intergenic
1158354665 18:56604568-56604590 CCTCAGACAAACCAAAATTTAGG + Intronic
1162703131 19:12534060-12534082 CCTCAGAAAGAACATCAATGAGG + Intronic
1163494253 19:17636058-17636080 CCTCATAGTGTCCATCATTGAGG - Exonic
1164849183 19:31466294-31466316 CCTCACAGAGTTCATCATTTAGG - Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
927373154 2:22381164-22381186 ACTAAGATAGACAATCATTTTGG + Intergenic
928077624 2:28279539-28279561 CCTCAGAGGGCTCATCATTTGGG - Intronic
932459511 2:71873219-71873241 CCTCAGAGTCTCCATCATTGTGG + Intergenic
937674934 2:124579767-124579789 ACTCTCAGTGACCATCATTTAGG - Intronic
939296104 2:140266448-140266470 CCTCAGAAATACCACTATTTGGG - Intronic
939908988 2:147956330-147956352 CCTCAAAGAGACAATCTGTTGGG + Intronic
940832540 2:158483543-158483565 CATCATAGAGACCATCAGTGTGG + Intronic
942585388 2:177470106-177470128 CTGCAGAGTGACCATCATGTTGG + Intronic
943107503 2:183564453-183564475 CATAAGAAAGACCATCTTTTTGG + Intergenic
943781794 2:191831872-191831894 CCACAGAGAGACTATTATTCAGG - Intergenic
945328245 2:208508639-208508661 CACAAGAGAGACCAACATTTTGG - Intronic
946940184 2:224762008-224762030 CTGCAGAGAGACCAACATTCAGG + Intergenic
1173613024 20:44384774-44384796 CCTCAGAGAGACTATAAGTAAGG + Intronic
1175970624 20:62685011-62685033 CCTCAGAGAGACCAGTAATGGGG + Intronic
1178379478 21:32095937-32095959 CCTCAGAGAGAACCTTGTTTTGG + Intergenic
1178833077 21:36072522-36072544 CCGCAGTGAGACCATCACTGAGG + Exonic
1182822738 22:33232663-33232685 CTCCAGTGAGACCATCATTTAGG - Intronic
1184867574 22:47210003-47210025 CCTGAGAGTGGCCATCATGTGGG - Intergenic
950166611 3:10805541-10805563 CCTTCAAGAAACCATCATTTTGG + Intergenic
957163957 3:76646743-76646765 CCTTAGACAAACCATCATTATGG - Intronic
963857856 3:150274141-150274163 CCTCTCAGAGACTATCATTAAGG + Intergenic
965309159 3:167107553-167107575 CCTCAGAGAAAGCACCATTTAGG - Intergenic
965420193 3:168448463-168448485 CCTGAGAAATACCATCACTTTGG - Intergenic
969042179 4:4307653-4307675 CCTCAGAAAGACCGGCATCTGGG - Intronic
970440764 4:16079398-16079420 CTTCAGAGGGACCTACATTTTGG - Intronic
971498617 4:27294382-27294404 CCTCAGAGAGTTCATTATTTAGG + Intergenic
974337732 4:60572065-60572087 CCTCATAGACAGCACCATTTAGG - Intergenic
975479013 4:74857111-74857133 CCTCACAGTGACCATCATGGTGG - Intergenic
975893175 4:79053539-79053561 CCTCAGAGAGACAAGCAGATGGG - Intergenic
976675881 4:87702957-87702979 CCCCAGAAAGATCATGATTTAGG - Intergenic
980877643 4:138678040-138678062 ACTCTGAGAGACCAACATTAAGG + Intergenic
982583711 4:157210512-157210534 CATCGGAGGGACAATCATTTCGG + Intronic
983164150 4:164453627-164453649 TCTCAGAGAGAACATTTTTTAGG - Intergenic
984225102 4:177025651-177025673 ACTCAGAGAAAACATTATTTGGG + Intergenic
986660087 5:10051800-10051822 CCTCACAGAGACCCTCTATTAGG - Intergenic
987434372 5:17876019-17876041 CAGCAGTAAGACCATCATTTAGG - Intergenic
988697488 5:33637653-33637675 GCTCAGAGGCACCAACATTTCGG - Exonic
993027407 5:82662754-82662776 CCTTAGAAAAACTATCATTTAGG + Intergenic
997491849 5:134284207-134284229 TCTCAGACAGACCAACACTTAGG - Intergenic
998226051 5:140327026-140327048 CCTCAGAGAGAGCTTCCTTGAGG + Intergenic
998529163 5:142869144-142869166 GCTCAGAAAGGCCATCATTGAGG - Intronic
1003454074 6:6264508-6264530 CTTCAGGAACACCATCATTTAGG - Intronic
1004867076 6:19864117-19864139 CCTCAGAAAAGCCATCTTTTAGG + Intergenic
1008306159 6:49902727-49902749 CTTCAGAGACAGCAACATTTTGG + Intergenic
1009548980 6:65061797-65061819 CCTCATAGGAACCATCATGTAGG + Intronic
1010870079 6:81026066-81026088 CCTGAGAAAGACCTTCATATAGG - Intergenic
1015593802 6:134847079-134847101 CCTCAGTGTGACCATCACTCTGG - Intergenic
1016743018 6:147548304-147548326 CCTCAGAGAGACCATCATTTCGG + Intronic
1018199716 6:161383700-161383722 CCTCAGAGCGAGCATCACTGGGG - Intronic
1018568343 6:165181847-165181869 CTTGAGAAATACCATCATTTAGG - Intergenic
1020730184 7:11870072-11870094 CCTCAGGGAGAACATCAACTAGG + Intergenic
1020846342 7:13289115-13289137 GCTCAGAGACTCCTTCATTTGGG - Intergenic
1021163641 7:17306599-17306621 CCTCAGTAATACCAACATTTAGG - Intronic
1023988064 7:45109598-45109620 CTGCAGAGATGCCATCATTTAGG - Intronic
1028158469 7:87458909-87458931 CCCCAGAGAGACCTTGAATTTGG + Intronic
1030197157 7:106863728-106863750 CCTCAGAGGGACCATGAGCTTGG - Intergenic
1030563044 7:111115089-111115111 TCCCAGAGAGACCTACATTTGGG + Intronic
1032094266 7:128929741-128929763 CCTCAGAGGGGCCGTCCTTTGGG - Intergenic
1032372472 7:131371361-131371383 GCTCTGGGAGTCCATCATTTAGG - Intronic
1035499187 8:78230-78252 CCTCAGAGAAGCCATCAGCTAGG - Intronic
1036241097 8:7081747-7081769 CCTCAAAGGGGACATCATTTCGG + Intergenic
1037144160 8:15553327-15553349 CCTCAAAGATACCAATATTTTGG + Intronic
1038293726 8:26272221-26272243 CATCAAAGAGACCATCCTTGGGG - Intergenic
1039249521 8:35646711-35646733 CATCAGTGATCCCATCATTTAGG - Intronic
1039375552 8:37029173-37029195 TCACAGAAAGACCCTCATTTTGG + Intergenic
1043811048 8:84741230-84741252 CCTCAGAGAGGCCAACACTGTGG - Intronic
1045363048 8:101450510-101450532 CCCCAGAGACACCACCATTTGGG + Intergenic
1051399742 9:16667833-16667855 CCTCAAGGAGAGCATCTTTTAGG + Intronic
1052882181 9:33608334-33608356 CAGAAGAGAGACCATCATTTGGG - Intergenic
1053362201 9:37496331-37496353 TCACAGAGAAACCATCACTTTGG - Intronic
1053470489 9:38342821-38342843 CCTCTGAAAAACCAACATTTGGG - Intergenic
1053494138 9:38537423-38537445 CAGAAGAGAGACCATCATTTGGG + Intergenic
1056106323 9:83350206-83350228 ATTCAGAGACACCATCATTTTGG - Intronic
1056444228 9:86649048-86649070 CCTCAGCCAGCCCATCGTTTTGG + Intergenic
1056617873 9:88184080-88184102 CTTCAGAGCGTCCATCACTTGGG - Intergenic
1057754375 9:97820122-97820144 CCTCACAGATAACATCATGTGGG + Intergenic
1188445312 X:30248555-30248577 CCTCAGTGTCACCATCTTTTAGG - Intronic
1195631576 X:107060997-107061019 CATCAGACAGACCCTCATTAGGG + Intergenic
1201587581 Y:15577846-15577868 CTTCAGAGTGACCTTGATTTGGG - Intergenic