ID: 1016744481

View in Genome Browser
Species Human (GRCh38)
Location 6:147563551-147563573
Sequence TTGTCCATCTAGATCTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016744476_1016744481 13 Left 1016744476 6:147563515-147563537 CCTTCTTCCTTCCAACTTTCCTT 0: 1
1: 2
2: 52
3: 666
4: 3453
Right 1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1016744477_1016744481 6 Left 1016744477 6:147563522-147563544 CCTTCCAACTTTCCTTTTCTTCC 0: 1
1: 0
2: 19
3: 299
4: 2471
Right 1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1016744478_1016744481 2 Left 1016744478 6:147563526-147563548 CCAACTTTCCTTTTCTTCCTCTT 0: 1
1: 6
2: 28
3: 468
4: 3127
Right 1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1016744479_1016744481 -6 Left 1016744479 6:147563534-147563556 CCTTTTCTTCCTCTTCTTTGTCC 0: 1
1: 1
2: 19
3: 362
4: 2881
Right 1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016744481 Original CRISPR TTGTCCATCTAGATCTGTCA AGG Intronic
903375449 1:22863038-22863060 TTGTCCATCTGGGACTTTCAAGG + Exonic
903880739 1:26507488-26507510 TTGTCCATGCTGATCTGTCGGGG + Intergenic
909687198 1:78363328-78363350 TTGTCCCTCAGTATCTGTCAGGG + Intronic
909867477 1:80692460-80692482 TTGTGCCTCTAGTTCTGTAATGG - Intergenic
911154067 1:94622267-94622289 CTGTCCATCCAAAGCTGTCAAGG - Intergenic
911536648 1:99107842-99107864 TTCTCCATCTAGAGCTCTAACGG - Intergenic
915876180 1:159613984-159614006 TTGGCCATCTTGTACTGTCAAGG + Intergenic
918066897 1:181107532-181107554 TTGTCCTTCTAGGGCTTTCAAGG - Intergenic
918917188 1:190658325-190658347 TTATCCATCTAGAATTGTTATGG + Intergenic
918917190 1:190658357-190658379 TTATCCATCTAGAATTGTTATGG + Intergenic
924015191 1:239713635-239713657 CTGTCCATGGAGATCTGTGATGG - Intronic
1067835455 10:49636431-49636453 TTTTCCATCTATATTTGTGAGGG + Intronic
1070572087 10:77647745-77647767 TTTTCTATCAAGATCTGTCTTGG + Intergenic
1070676841 10:78417767-78417789 ATGACCATCTAGATATGTCTGGG + Intergenic
1077738567 11:4819168-4819190 ATTTCCATCTAGATTTTTCATGG - Intronic
1077773744 11:5249164-5249186 TTGTCCATCTAGATTTTTAGAGG + Intronic
1079945896 11:26740323-26740345 CTCTCCATCTAGAGATGTCAGGG + Intergenic
1080022380 11:27576297-27576319 TTGGCCATCTAGATTCTTCATGG - Intergenic
1080057223 11:27918658-27918680 TTCTCCCTCTCAATCTGTCATGG + Intergenic
1084741773 11:71144729-71144751 TTTTCCAGCTAAATCTGTGAAGG - Intronic
1086070037 11:82790072-82790094 TTGCCCATCAAGATCTAGCAAGG + Intergenic
1086538268 11:87876440-87876462 TTGTATATCTAGTTCTGTCTTGG + Intergenic
1089124626 11:116168084-116168106 TCTTCCATCTGGATCTGTTAAGG + Intergenic
1096384407 12:51185428-51185450 TTGTCCTTCCATATCTGTCGGGG + Intergenic
1097354253 12:58583921-58583943 TGGGTCATCTAGATATGTCATGG - Intronic
1098723386 12:73930458-73930480 TTGTTCATGTATATATGTCAAGG + Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1100802815 12:98251322-98251344 TTTTTCATCTAGATTTGTCTGGG - Intergenic
1100915026 12:99410838-99410860 TTCTCTCTCTAGATCTGTTATGG + Intronic
1101827191 12:108229613-108229635 GTTTCCATCCAGAACTGTCATGG - Intronic
1103239955 12:119404762-119404784 ACGACCCTCTAGATCTGTCATGG - Intronic
1105717968 13:23085640-23085662 TTGTCCATCTAGATTCTTCCTGG - Intergenic
1107422009 13:40255837-40255859 ATGTGCATCTATATCTGTCGTGG - Intergenic
1108750663 13:53445132-53445154 TTGTTCATCTAAAGCTGTCAAGG - Intergenic
1110673935 13:78216253-78216275 TTGGATATCAAGATCTGTCAGGG + Intergenic
1111179703 13:84647565-84647587 TTATCCTTCTATATCTGCCAGGG + Intergenic
1115022504 14:28699665-28699687 TTGTCCATCGAGATGTTTCCTGG + Intergenic
1117697912 14:58384949-58384971 TTCTCCACCTAGGTATGTCATGG + Intergenic
1119842451 14:77803456-77803478 TTTCCCATTTAGTTCTGTCAAGG + Intronic
1124268045 15:28255021-28255043 TTGGCCATGTAGAGCTGCCACGG - Intronic
1124900564 15:33818818-33818840 TTGGCCATCAAGATATGTCTAGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128977675 15:72165438-72165460 TTGTCCATCTGGAACAGGCAAGG + Intronic
1129980239 15:79862831-79862853 TGGTCCATCTACATTTGCCATGG + Intronic
1135375334 16:21941870-21941892 ATATCCATCTACATGTGTCAAGG - Intergenic
1147922889 17:43929197-43929219 TTGTCCAGCAAGATATGACAAGG + Intergenic
1149245865 17:54706969-54706991 TTTTCCTTCTAGTTCTGTGAAGG + Intergenic
1153400782 18:4682092-4682114 CTGTCCCTCTGGATCTGGCAGGG + Intergenic
1156042403 18:32837177-32837199 TTGTGCTTCTAGCTCTGTCTTGG + Intergenic
1156503695 18:37575846-37575868 TTGTCAGTCTAGCCCTGTCAAGG - Intergenic
1158995993 18:62920346-62920368 TTGTCCATAAACATGTGTCATGG + Intronic
1164305050 19:23998648-23998670 TTGTCCACCTAGACATGGCAAGG + Intergenic
1166035738 19:40166965-40166987 TTCCCCATCTCTATCTGTCAGGG - Intergenic
1168379465 19:55907761-55907783 TTGGCTCCCTAGATCTGTCAAGG - Intronic
927564800 2:24102963-24102985 TTGTCCATCTATATTTCTTAAGG - Intronic
928354641 2:30599530-30599552 TTTTCTGTCTTGATCTGTCAGGG + Intronic
930549935 2:52820806-52820828 TTTCCCACCTAGCTCTGTCATGG - Intergenic
931074741 2:58697232-58697254 TTATCCAACCAGATCTCTCAGGG - Intergenic
931471368 2:62540970-62540992 TTGAACATCTATATCTGGCAAGG + Intergenic
931882915 2:66585526-66585548 GTGGCAATTTAGATCTGTCATGG + Intergenic
933169750 2:79111850-79111872 TTGGCATTCTAGATCTGTGATGG + Intergenic
935985857 2:108672462-108672484 TTGTCCACCCACATCTGACAAGG - Intronic
936138288 2:109916089-109916111 TTGTCCACCCACATCTGACAAGG - Intergenic
936206408 2:110455396-110455418 TTGTCCACCCACATCTGACAAGG + Intronic
937407427 2:121643431-121643453 TTCTCAATCTAGATCAATCAGGG + Intronic
937829416 2:126403306-126403328 TTGTCCAGCTCCATCTGTCATGG - Intergenic
939231941 2:139438763-139438785 TTGTCCAGCTCTATTTGTCAGGG + Intergenic
941229463 2:162892635-162892657 TTTTTCATCTTGAACTGTCAAGG - Intergenic
946818866 2:223609906-223609928 TTGTCCCTCCAGTTCAGTCATGG + Intergenic
946950950 2:224874400-224874422 TTGGCCATGTGGATGTGTCAGGG - Intronic
947088951 2:226488545-226488567 TTGTCCATCTGGTTCTGGTAGGG - Intergenic
947286289 2:228519030-228519052 TTGTCCATCTAGAGAAGTAAGGG - Intergenic
948575325 2:238946197-238946219 TTCTCCATCTTGGTCTGTTATGG + Intergenic
1173403579 20:42745710-42745732 TATTCCATATATATCTGTCACGG + Intronic
1182002106 22:26927970-26927992 TTGCAGATCCAGATCTGTCATGG + Intergenic
1182370881 22:29809927-29809949 TGGTACATCCATATCTGTCACGG + Intronic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
951072357 3:18346272-18346294 TTGTGCATCTGAATCTGTCATGG - Intronic
951299187 3:20973295-20973317 GTGTCCATATATATCTTTCAAGG + Intergenic
955242914 3:57195697-57195719 TTGTCAATCGATATCTGTGATGG + Intergenic
955860573 3:63325566-63325588 TTCTCCATCTGGACCTGGCAGGG + Intronic
957272820 3:78053672-78053694 TTCTCCAGCTAGATTTTTCATGG + Intergenic
957352839 3:79048458-79048480 TTGTACATCTAATTCTGTCTTGG + Intronic
958078883 3:88719768-88719790 GTCTCTCTCTAGATCTGTCATGG + Intergenic
958729388 3:97945264-97945286 TAGTCCAGCTATTTCTGTCAAGG - Exonic
964972743 3:162581330-162581352 TTGTGCATCTATATTTATCAAGG - Intergenic
978627132 4:110699779-110699801 TTTTGCATCTAGATTTATCAAGG + Intergenic
980600947 4:135024145-135024167 TTGACAATATATATCTGTCATGG + Intergenic
983396892 4:167210001-167210023 ATATCCATCAAAATCTGTCAAGG + Intronic
995550078 5:113272437-113272459 TTTTTTATTTAGATCTGTCAGGG - Intronic
997745992 5:136300882-136300904 TGGTTCATCTAGATCTCTGAAGG - Intronic
1004122639 6:12839513-12839535 TGGCCCTTCTAGATATGTCATGG + Intronic
1004407612 6:15348967-15348989 TTGTCCATGGAGTTCTTTCATGG - Intronic
1005405987 6:25488536-25488558 TTGTCCACCTCGACCTCTCAGGG + Exonic
1005660963 6:27998973-27998995 GTCTTCATCTAGATCTGTGAGGG + Intergenic
1006528077 6:34625507-34625529 TTGTACACCTTGATCTGTGATGG + Intronic
1006945729 6:37783471-37783493 TTCTCCATGAAGATCTGCCAGGG - Intergenic
1007201289 6:40111657-40111679 TTCTCCGTGTAGATCTGTCTTGG - Intergenic
1011985412 6:93437400-93437422 TGGTCCATCAAGCTCTGACAGGG - Intergenic
1014967811 6:127777993-127778015 TTGTCAATGTACATTTGTCAAGG - Intronic
1015320791 6:131871679-131871701 CTATCCATCTAGATCTGGTATGG - Intronic
1015325913 6:131923225-131923247 TTCTGTATCTAGATCTGTAAAGG - Intergenic
1015815333 6:137205111-137205133 TTTTCCATATAGATTTATCAAGG - Intronic
1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG + Intronic
1022290732 7:29000289-29000311 TTGTTGATGTAGATGTGTCAGGG + Intronic
1032790928 7:135241882-135241904 CTGACCACCTATATCTGTCAGGG - Intronic
1033820515 7:145129367-145129389 TCCTCCATCTAGCTCTGTCATGG - Intergenic
1035033700 7:155881634-155881656 GTGTCCACCCAGAGCTGTCATGG + Intergenic
1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG + Intergenic
1039715979 8:40109790-40109812 TTTTGCATCTATATCAGTCAGGG + Intergenic
1047063202 8:121250852-121250874 TTGTGCATCCACATATGTCATGG - Intergenic
1047358323 8:124144340-124144362 TTCCCCCTCTAGATCTGTGATGG + Intergenic
1048791455 8:138107729-138107751 TTGCGCATCTAGATCTGTGTTGG + Intergenic
1050210166 9:3245026-3245048 TTCTACTTCTAGCTCTGTCATGG - Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1053121189 9:35548370-35548392 TGGTCCACCCAGGTCTGTCAGGG + Exonic
1188655489 X:32689624-32689646 TTTTGCCTCTATATCTGTCAAGG - Intronic
1190260081 X:48791982-48792004 TTTTCCATCCAGATCTTCCACGG - Exonic
1190978953 X:55437892-55437914 TTTTGCATCAATATCTGTCAGGG - Intergenic
1192165106 X:68823263-68823285 TTGTCAATCGAGGTTTGTCAGGG + Intergenic
1196340275 X:114586641-114586663 ATCTCCATCTAGAGGTGTCATGG + Intronic
1196557221 X:117101931-117101953 TTTTCAATCTACATCTGGCAAGG - Intergenic
1197346671 X:125332460-125332482 TTGTCCCTCTAAATCTCTTAGGG + Intergenic
1199078400 X:143549748-143549770 TTGAGCATATAGATCTGTCAGGG - Intergenic
1199497475 X:148469091-148469113 TTGGCCATTTATATCTGCCATGG + Intergenic
1200065269 X:153501780-153501802 TTGTCCTTCTGCCTCTGTCACGG + Intronic