ID: 1016746823

View in Genome Browser
Species Human (GRCh38)
Location 6:147589648-147589670
Sequence TGGAGTCATACCCATGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016746823_1016746824 -10 Left 1016746823 6:147589648-147589670 CCAACTGCATGGGTATGACTCCA 0: 1
1: 0
2: 0
3: 13
4: 104
Right 1016746824 6:147589661-147589683 TATGACTCCACCATAACTTAAGG 0: 1
1: 0
2: 1
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016746823 Original CRISPR TGGAGTCATACCCATGCAGT TGG (reversed) Intronic
901562534 1:10084083-10084105 TGGAGTCAGAAGCAGGCAGTTGG - Intronic
904478010 1:30776955-30776977 CGGAGTCAGACCCATGGAGTCGG + Intergenic
905165734 1:36082106-36082128 TGGATTGAAACCCAGGCAGTTGG - Intergenic
907181576 1:52575161-52575183 AGGATTCAAACCCAAGCAGTTGG + Intergenic
910077062 1:83293534-83293556 TGGATTCATATACATGCAGATGG - Intergenic
910776631 1:90883062-90883084 GGGAATCATTCCCAGGCAGTAGG + Intergenic
910936520 1:92487055-92487077 TGAGGTCATACCCAGGCACTGGG + Intergenic
914349700 1:146830406-146830428 TGGACTCATACCCTGGCAGTTGG - Intergenic
914515766 1:148372793-148372815 TAGAGTCATACATATTCAGTAGG - Intergenic
919199427 1:194335397-194335419 TGGATTCAAACCCCTGCTGTTGG + Intergenic
921439354 1:215166257-215166279 ATGAGTCATACCGATGCAGAGGG + Intronic
921950016 1:220919696-220919718 TTGAGTCTAACCCAAGCAGTAGG - Intergenic
923120837 1:230989582-230989604 TTGAGTCATACTCATCCAGCTGG + Intronic
924951220 1:248885395-248885417 TGTAGTCCTAGCCATGCAGGAGG - Intergenic
1064259422 10:13773208-13773230 TAGAGTCATACACATTCAGCAGG - Intronic
1065492691 10:26297825-26297847 TAGAGTCATACATATTCAGTAGG + Intronic
1067742990 10:48910655-48910677 TTGAGACATACACAGGCAGTGGG - Intronic
1068124191 10:52817802-52817824 TAGAGTCTCACCCATGCTGTCGG - Intergenic
1072163533 10:92789824-92789846 TGGAGTCTACCGCATGCAGTAGG + Intergenic
1075170057 10:120104802-120104824 TGGAGTCACACCTAGGCTGTGGG - Intergenic
1081927034 11:46839328-46839350 TGGAGTTATACACATCAAGTAGG + Intronic
1083192565 11:61062841-61062863 TGGACTCATCTCCACGCAGTAGG - Intergenic
1083306226 11:61763204-61763226 TGGAGTCAGACCCCTGCACCTGG + Intronic
1083805619 11:65072216-65072238 TGGACTGATACCCAAGCAGGTGG + Intronic
1084485845 11:69447688-69447710 TGGAGACAATCCCAGGCAGTGGG - Intergenic
1084648147 11:70472748-70472770 AGGAGACAAACCCATGGAGTGGG + Intronic
1088702079 11:112422399-112422421 TGGAGTTACAACCATGCAGTGGG - Intergenic
1091013216 11:132025211-132025233 TGTAGTCATTCACATGCCGTTGG + Intronic
1092361405 12:7839760-7839782 GGGAGTAATACCCATACAGAAGG + Intronic
1092862420 12:12730325-12730347 TGGACTCAAACCCAGGCAGTAGG - Intronic
1094225283 12:28038752-28038774 TGGAGACATTCACATGCAGAGGG + Intergenic
1095871753 12:47035799-47035821 GGGATTCAAACCCAGGCAGTTGG + Intergenic
1101627263 12:106457643-106457665 TGGAGTCATACCTTTGCAGGGGG - Intronic
1102428261 12:112861570-112861592 GGGACTCAGACCCAGGCAGTCGG - Intronic
1104841901 12:131829538-131829560 TGGACTCCTACCCAGGGAGTCGG + Intronic
1107899755 13:45000306-45000328 TGTAGTCCTAGCCATGCAGGAGG + Intronic
1108117391 13:47144496-47144518 GGGTGTCATACCCAGGCTGTGGG - Intergenic
1111320085 13:86615588-86615610 TGTAGTCATAGCTATGCAGGAGG - Intergenic
1117621487 14:57591607-57591629 TGGAGTCATACTGATTCAGTTGG - Intronic
1120574057 14:86158862-86158884 TCTAGTCATACACATACAGTAGG - Intergenic
1122035764 14:98948229-98948251 TGGAGTCAGACAGTTGCAGTTGG + Intergenic
1122130391 14:99601891-99601913 GGGAGACATACCCATGGAGGTGG - Intronic
1124885322 15:33680015-33680037 TGGATTCAAACCCATGCTGCTGG - Intronic
1125903984 15:43373605-43373627 GGGATTCAAACCCAGGCAGTTGG + Intronic
1126293184 15:47105778-47105800 TGGCGGCACACCCTTGCAGTCGG - Intergenic
1126485411 15:49175026-49175048 TAGAGTCATACATATTCAGTAGG + Intronic
1136986478 16:35110283-35110305 TGGAGTCATACACTCACAGTAGG + Intergenic
1139984335 16:70885140-70885162 TGGACTCATACCCTGGCAGTTGG + Intronic
1140159661 16:72475408-72475430 TGAATTCAAACCCAGGCAGTCGG - Intergenic
1145772942 17:27506602-27506624 TGGAGTCTTCCCTTTGCAGTTGG + Intronic
1145786714 17:27598396-27598418 TGGAGCCATACCCAGCCAGCAGG + Intronic
1146373289 17:32278628-32278650 TGGATTCATATCCAGGCAGAGGG - Intronic
1148860001 17:50599820-50599842 CGGCGTCATCCCCATCCAGTGGG - Exonic
1149495997 17:57117914-57117936 GGGAATCAAACCCAGGCAGTTGG - Intronic
1153241793 18:3037780-3037802 TGGAGTTTTAGCCCTGCAGTGGG - Intergenic
1156624240 18:38889146-38889168 TGGAGCCTTATCCATGCAGATGG - Intergenic
1157113762 18:44844382-44844404 TGAAGTCAGAGCAATGCAGTAGG - Intronic
1158511977 18:58098498-58098520 AGGATTCAAACCCAGGCAGTCGG - Intronic
1162054372 19:8053904-8053926 TCAAGTCAGAGCCATGCAGTGGG - Intronic
1164253230 19:23503278-23503300 TGCATTTATAGCCATGCAGTAGG + Intergenic
1164791656 19:30990497-30990519 GGAAGTCATCCCCAGGCAGTGGG + Intergenic
1164826719 19:31289602-31289624 TCCAGTCAGATCCATGCAGTGGG - Intronic
1167668679 19:50837468-50837490 TGAGGTCATACCCATGGAGCAGG + Intergenic
928287677 2:30007765-30007787 TGGAGTCTTCCACCTGCAGTGGG - Intergenic
929671261 2:43877752-43877774 TGGAGACACAGACATGCAGTGGG - Intronic
930173034 2:48271035-48271057 TGGCCTGATACCCCTGCAGTGGG + Intergenic
938065259 2:128278546-128278568 GGGAGTCATGGCCATGCAGGCGG + Intronic
938810204 2:134845839-134845861 TGAAGTCAGACCCATGCCCTGGG - Intronic
944223770 2:197328668-197328690 TCGCTTCAGACCCATGCAGTAGG - Intergenic
944700267 2:202239701-202239723 TGGAGGCATTCTCATGAAGTAGG - Intergenic
947106133 2:226669705-226669727 TGGAGTCATCAACATGCAGATGG + Intergenic
947332181 2:229041384-229041406 TGGATTCCTACCCATTCTGTGGG - Intronic
948655466 2:239474135-239474157 TGGAGCCATAAGCATGCAGGTGG - Intergenic
1169613939 20:7417313-7417335 TGGAGTCAGAATGATGCAGTGGG - Intergenic
1174563258 20:51446152-51446174 TGGAGTCATAGCCTGGCAGCTGG - Intronic
1177835009 21:26178193-26178215 TGGAGTCATACATATTCAGCAGG - Intergenic
1178059126 21:28832875-28832897 TGGAGTAACACCCATGCACTAGG + Intergenic
1181041117 22:20193080-20193102 TGGATTCAGACCCATGCATTTGG + Intergenic
1182807142 22:33082658-33082680 TGAAATCATTCCCATGCATTTGG - Intergenic
1185198809 22:49489960-49489982 GGGAGTCACGCCCAGGCAGTGGG - Intronic
955925692 3:64002372-64002394 TGGATTCATACAGATGAAGTGGG + Exonic
959267185 3:104157382-104157404 TAGATTCATAGCCATGGAGTGGG + Intergenic
960944924 3:122959326-122959348 TGGATTCAAACCCAGGCAGTCGG + Intronic
961185096 3:124907840-124907862 TGGAGTCGTATTCATGGAGTTGG + Intronic
967591880 3:191286425-191286447 TAGTGTCATACCATTGCAGTTGG - Intronic
970418550 4:15883083-15883105 TGGATTCCTTCCCATGCAGCTGG - Intergenic
975881064 4:78908567-78908589 GGGAGTTATCACCATGCAGTTGG - Intronic
978855184 4:113386516-113386538 TGGGGGCATAGCCATTCAGTAGG - Intergenic
979956293 4:126956791-126956813 TGGAGTAATACTCAGGCAGAAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
994870855 5:105349073-105349095 TGGTTTCATACTGATGCAGTAGG + Intergenic
996009842 5:118469648-118469670 TGCGGTCATACCCATCCTGTTGG - Intergenic
996072225 5:119144911-119144933 TGGGGTCCTACCCATCCATTTGG + Intronic
999682624 5:154074293-154074315 TTGATTAATACCCATGAAGTAGG - Intronic
1006861816 6:37176713-37176735 TGTAGTCCTACCTATGCAGGAGG + Intergenic
1014963992 6:127723515-127723537 TGGAGTCATAAACATACAGGTGG - Intronic
1016587100 6:145701434-145701456 TGGAGTCCTAACCATGAAGAAGG + Intronic
1016746823 6:147589648-147589670 TGGAGTCATACCCATGCAGTTGG - Intronic
1017094419 6:150791829-150791851 TGGTGGCATAACCATGCAGTAGG + Intronic
1021454972 7:20820037-20820059 TGGAGTCCTACCTATGCAACAGG - Intergenic
1021716694 7:23468759-23468781 TGGACTGATACCCAAGTAGTGGG - Intronic
1023029486 7:36079874-36079896 TGGACTCTGACCCAGGCAGTAGG - Intronic
1023961766 7:44933242-44933264 TGGAGTCAGCCTCATGAAGTAGG - Intergenic
1024922073 7:54568639-54568661 TGGATTTATGCTCATGCAGTAGG + Intronic
1024966007 7:55022323-55022345 TGGAGACGTTCCCATTCAGTAGG + Intronic
1027294833 7:76758745-76758767 TGGATTCATATACATGCAGATGG - Intergenic
1050171839 9:2827926-2827948 AGGAGTCGTACCCAGGCAGTCGG + Intronic
1051713475 9:19957476-19957498 TGGATTCACAGCCATTCAGTTGG + Intergenic
1052423680 9:28276087-28276109 TTGACTCATAGCCAAGCAGTGGG - Intronic
1052689699 9:31801942-31801964 TGGTGTCTTACCCATGATGTTGG + Intergenic
1056128692 9:83563257-83563279 TGGAGTCTTAGACACGCAGTAGG - Intergenic
1186758892 X:12702425-12702447 AGGATTCAAACCCAGGCAGTGGG + Intronic
1187509519 X:19905061-19905083 AGAAGTCATCCCCATCCAGTTGG + Intergenic
1188528665 X:31113536-31113558 TGGAGTCATCATCATGCAGAAGG + Intronic
1195908268 X:109865933-109865955 TGGGGTCCTCCCCATGCAGTAGG - Intergenic
1196404769 X:115349580-115349602 AGGATTCAAACCCAGGCAGTTGG - Intergenic
1197862943 X:130989557-130989579 TGAAGTTCTCCCCATGCAGTAGG - Intergenic
1201579481 Y:15495712-15495734 GGGATTCATATCCATGGAGTAGG + Intergenic