ID: 1016751309

View in Genome Browser
Species Human (GRCh38)
Location 6:147633353-147633375
Sequence CCGCAGCCCAAAAGAGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016751309_1016751312 4 Left 1016751309 6:147633353-147633375 CCGAGGGCTCTTTTGGGCTGCGG 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1016751312 6:147633380-147633402 TTATTCCTTCTGTCGCCAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1016751309_1016751313 5 Left 1016751309 6:147633353-147633375 CCGAGGGCTCTTTTGGGCTGCGG 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1016751313 6:147633381-147633403 TATTCCTTCTGTCGCCAGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1016751309_1016751314 6 Left 1016751309 6:147633353-147633375 CCGAGGGCTCTTTTGGGCTGCGG 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1016751314 6:147633382-147633404 ATTCCTTCTGTCGCCAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1016751309_1016751311 3 Left 1016751309 6:147633353-147633375 CCGAGGGCTCTTTTGGGCTGCGG 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1016751311 6:147633379-147633401 CTTATTCCTTCTGTCGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016751309 Original CRISPR CCGCAGCCCAAAAGAGCCCT CGG (reversed) Intronic
909081534 1:71118311-71118333 ACGCAGCCCAAGAGAGTCCATGG - Intergenic
912391668 1:109307185-109307207 CAGCAGCCCAGAATAGCCCCAGG + Intergenic
917267558 1:173237514-173237536 TCTCAGCCCAAAAGCTCCCTGGG + Intergenic
917485900 1:175454421-175454443 CTGCAGTCCAGCAGAGCCCTCGG + Intronic
919926352 1:202193856-202193878 CCGCCGCCCAATAGAGCCCCTGG + Intergenic
920722362 1:208399638-208399660 CAGCAGCCCAACAGAGGCCCAGG - Intergenic
924188251 1:241519376-241519398 CCGCAGCCCGGGAGAGCGCTTGG - Intronic
1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG + Intronic
1065335587 10:24654384-24654406 CCTCAGCCCAAAATATCCTTAGG + Intronic
1071257089 10:83880554-83880576 CTGCAGCCCATGACAGCCCTGGG + Intergenic
1071334677 10:84591017-84591039 CTGCAGCTCACGAGAGCCCTGGG - Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1073623544 10:105073517-105073539 CCACAGCCAAAAACAGCCCAAGG - Intronic
1083208988 11:61170933-61170955 AAGCATCCCAGAAGAGCCCTCGG + Intergenic
1083991382 11:66247870-66247892 CCTTAGCCCAAAAGACACCTGGG + Intergenic
1086423039 11:86656585-86656607 CCCCACCCCAAAACAGGCCTTGG - Intronic
1086954408 11:92920845-92920867 CCTCACCCAAAAAAAGCCCTGGG - Intergenic
1091097123 11:132834542-132834564 CCGCAGGCCAAAGAAGGCCTGGG - Intronic
1091373665 12:12888-12910 CGCCAGCCCAGCAGAGCCCTAGG - Intergenic
1097570201 12:61322702-61322724 CCCCACCCCAAAACAGCCCCTGG - Intergenic
1098195657 12:67998885-67998907 CCCCAGCCCCAAAGAGGCATTGG + Intergenic
1100469049 12:94873816-94873838 CCGCAGCCCGGGAGAGCCCCGGG - Intergenic
1100658851 12:96675925-96675947 CCCCACCCCAAAACAGGCCTCGG - Intronic
1101557828 12:105827263-105827285 CCGCACCCCAAAACAGGCCCCGG - Intergenic
1103424554 12:120821385-120821407 CTGCAGCCGGAAACAGCCCTGGG + Intronic
1104858505 12:131912918-131912940 CCTCAGCCCCAGAGACCCCTGGG - Intronic
1105700962 13:22935494-22935516 CCTCAGCCAAAAAGAGCCAGGGG - Intergenic
1105853792 13:24358543-24358565 CCTCAGCCAAAAAGAGCCAGGGG - Intergenic
1107784290 13:43939188-43939210 CCTCAGCCCAGAAGAGGCCCAGG + Intergenic
1108313417 13:49217304-49217326 TCGCAGCCCATGAGAGCCATGGG + Intergenic
1111997068 13:95175747-95175769 CAGCAGGCCAAGAAAGCCCTCGG + Intronic
1112328079 13:98457138-98457160 CCCCAGCCCAGAGGGGCCCTGGG + Intronic
1114549783 14:23526053-23526075 ACGCAGCCAAGAAGAGCCCAAGG - Exonic
1117092382 14:52264212-52264234 CCCCAGCCCAAAATATCACTTGG + Intergenic
1120439744 14:84521011-84521033 CTGCAGCCTAAAAGTGCTCTGGG - Intergenic
1120817190 14:88873374-88873396 CATCAGTCTAAAAGAGCCCTTGG + Intronic
1122009865 14:98737165-98737187 CCGCAGCTCACACGAGCCTTGGG + Intergenic
1122960328 14:105091190-105091212 CCACAGCCCAAAAGCTCCCCAGG - Intergenic
1123019352 14:105390375-105390397 CTGCAGCCCAAGTGAGCACTGGG - Intronic
1126841858 15:52725173-52725195 CAGCAGCCAGAGAGAGCCCTTGG - Intergenic
1127689219 15:61377996-61378018 CAGCAGCCCAGAAGAGTCCCTGG - Intergenic
1132877013 16:2144439-2144461 CCCCAGCCAAAACGACCCCTGGG - Intronic
1132947247 16:2538292-2538314 CCGCAGCCAAGCAGCGCCCTCGG - Intronic
1132968468 16:2673164-2673186 CCGCAGCCAAGCAGCGCCCTCGG + Intergenic
1134381285 16:13729056-13729078 CCCCACCCCAAACCAGCCCTTGG + Intergenic
1138215288 16:55199487-55199509 CCTCAGCCCAAAAAAGCCACAGG + Intergenic
1139660423 16:68416965-68416987 CAGCCACCCCAAAGAGCCCTTGG - Intronic
1141256144 16:82404130-82404152 CCACAGCCCAAATGATCCCCAGG - Intergenic
1142126777 16:88414409-88414431 CCTCCACCCCAAAGAGCCCTGGG + Intergenic
1142150552 16:88510749-88510771 CCTCAGCTCAGAAGAGCCCTGGG + Intronic
1146242476 17:31243473-31243495 CCGCAGCAGAATAGAGCACTAGG - Intronic
1147616561 17:41832206-41832228 CAGCAGCCACAAAAAGCCCTGGG + Intronic
1148167047 17:45490822-45490844 GCGCAGCCCGAAGGAGCCTTGGG + Intergenic
1150398225 17:64837227-64837249 GCGCAGCCCGAAGGAGCCTTGGG + Intergenic
1150626200 17:66842702-66842724 CCTCAGGCCATAAGAGCCCCAGG + Intronic
1151714853 17:75826057-75826079 ACACAGCCCTAAAGAGTCCTAGG - Intergenic
1151819861 17:76491543-76491565 CCGCAGAGCACAAGAGGCCTGGG + Intronic
1154367661 18:13726296-13726318 CCGCTGCCCCACAGAGGCCTGGG + Intronic
1160046324 18:75390500-75390522 CCGCAGAACACAAGAGCCATGGG - Intergenic
1161248793 19:3269701-3269723 CCCCAGCCCACAGGACCCCTTGG + Intronic
1161685490 19:5700718-5700740 CCACAGCACACAAGAGTCCTGGG + Intronic
1164631083 19:29761844-29761866 CCACTGCCCAAGAGAGCCCAGGG - Intergenic
1164675164 19:30095816-30095838 CAGCAGAGCACAAGAGCCCTGGG + Intergenic
1166042542 19:40212680-40212702 CTGGAGTTCAAAAGAGCCCTTGG + Intronic
926155672 2:10452598-10452620 CTGGAGCCCAGAAGGGCCCTGGG + Intergenic
927187529 2:20492401-20492423 CTGCAGCCCAAGGGGGCCCTGGG - Intergenic
930018568 2:46987120-46987142 CCCCAGTGCAAAAGAGCCCTCGG + Intronic
930109244 2:47664583-47664605 GCCCGGCCCAAAAGAGCCTTTGG + Intergenic
931560869 2:63559530-63559552 CCTCAGCCCAAAAGTGTCTTAGG + Intronic
931706724 2:64952318-64952340 CCGGAGCCCAAAGGAGGACTGGG + Intergenic
932496013 2:72146118-72146140 CCGAATCCCACAAGAGCCCCTGG - Intronic
940639935 2:156334377-156334399 CTGCGGCGCAAAAGAGCCCGCGG - Intronic
944612657 2:201427327-201427349 CCGCACCCCAAAACAGGCCCTGG + Intronic
944715863 2:202376037-202376059 CCGCAGCCCCACCCAGCCCTCGG + Intergenic
946940976 2:224769964-224769986 CCACAGTCCAAATGAACCCTGGG - Intronic
947241688 2:228001723-228001745 CCGCAGCCCACAACAGGCCCTGG + Intronic
1172864453 20:38084981-38085003 CCCTAGCCCAGAAGAGCCGTGGG - Intronic
1173800327 20:45891021-45891043 CCGCCGCCCAAAATAGCCCCCGG - Exonic
1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG + Intergenic
1177487937 21:21783202-21783224 CCGCAGCACAATAGAACCCAAGG - Intergenic
1177830701 21:26135790-26135812 ACGAAGCCCCAGAGAGCCCTTGG + Intronic
1180082711 21:45494022-45494044 CAGCCGCCCAGAAAAGCCCTCGG + Intronic
1181065607 22:20304306-20304328 CACAAGCCCAAAACAGCCCTAGG + Intergenic
1182241358 22:28918829-28918851 CAGCAGCCTAAAAGAACGCTGGG + Intronic
1182284194 22:29234327-29234349 CCGCTGCCCAGCAGAGCCTTGGG - Exonic
1182519010 22:30874851-30874873 CGGCTGCCCAAGAGAGGCCTTGG - Intronic
1184654892 22:45936086-45936108 CCACAGCCCTCAAGAGCACTGGG + Intronic
1203284295 22_KI270734v1_random:147096-147118 CACAAGCCCAAAACAGCCCTAGG - Intergenic
954239864 3:49285087-49285109 CCCCAGCCCCAAAAAGCCTTTGG + Intronic
955416212 3:58694337-58694359 CCTCAGCCGAAAAGTGCCCTAGG - Intergenic
956750402 3:72340222-72340244 CCACAGCCCTCAAGAGCCCAGGG + Intergenic
963824168 3:149933109-149933131 CCTCAGCTCAAAAGGGCCCCTGG - Intronic
966931650 3:184679244-184679266 CTGCAGCTCGAAAGAGCCCCTGG + Intronic
968064111 3:195748694-195748716 CTGAAACCCAAAAGAGCCATAGG - Intronic
968913088 4:3485623-3485645 CCGCAGCCCAAAGGGGCCCTTGG - Exonic
969505603 4:7585332-7585354 CCGCAGCCCAAACCACCCCTTGG - Intronic
969826832 4:9764442-9764464 CCTCAGCTCAGAAGTGCCCTTGG + Intergenic
983784591 4:171715650-171715672 CTGAAGCCCATAAAAGCCCTAGG + Intergenic
990536579 5:56729399-56729421 CAGCAGCCCAAAAGCCTCCTAGG + Intergenic
998392687 5:141797489-141797511 TCTCAGCCCCAAAGAGCCCAAGG + Intergenic
1001127899 5:169037041-169037063 CCTCTGCTCAGAAGAGCCCTTGG - Intronic
1001455252 5:171855204-171855226 CAGCAGCCCCAAAGAGTCATGGG - Intergenic
1007248101 6:40476796-40476818 CCACAGCCCAGAACAGGCCTCGG + Intronic
1007528719 6:42521296-42521318 CCTCAGCCTAATACAGCCCTGGG - Intergenic
1007817034 6:44531795-44531817 CCGCACACCAGAGGAGCCCTGGG + Intergenic
1011179583 6:84604799-84604821 CCCCACCCCAAAACAGGCCTAGG - Intergenic
1014724841 6:124962211-124962233 CCGCAGCCCCAGCGAGCCCCAGG - Intergenic
1016594374 6:145782895-145782917 CAACATCCCACAAGAGCCCTGGG + Intergenic
1016751309 6:147633353-147633375 CCGCAGCCCAAAAGAGCCCTCGG - Intronic
1018787576 6:167120216-167120238 CCCCAGCCCAATCGAGCCTTCGG - Intergenic
1019530758 7:1502071-1502093 CCACAGCCCACAAGTCCCCTGGG + Intronic
1019732054 7:2633919-2633941 CTGCAGCCCACAAGAGCCTCCGG + Intronic
1023151496 7:37205170-37205192 CTGCTGCCCAAAAGCTCCCTGGG + Intronic
1031974883 7:128087293-128087315 CCACTGCCCAAAAGCCCCCTGGG - Intronic
1034427854 7:151024001-151024023 CCGCAGCCCAGGAGAGTCCTGGG + Exonic
1035191771 7:157176018-157176040 CCACAGGCCAAACCAGCCCTAGG - Intronic
1039864718 8:41490727-41490749 CCGCCGCCGAAAACAGCCCAAGG - Exonic
1048391815 8:133974063-133974085 CAGCACCCAAAAAGAGCTCTGGG - Intergenic
1049105620 8:140610651-140610673 CCACAGCCCAAAAGAGAACACGG + Intronic
1051689526 9:19695333-19695355 CCAAAGCCCAAAAGAGCCTTTGG - Intronic
1052654231 9:31335003-31335025 CTGAGGCCCATAAGAGCCCTGGG - Intergenic
1056255603 9:84795850-84795872 TTGCAGCCCAACAGAGCCATAGG - Intronic
1058203083 9:102067590-102067612 CCGGAGCCAAAAAGAGCAGTAGG + Intergenic
1059115968 9:111600076-111600098 CCGCAGCCCTAATAAGCCCCCGG + Intergenic
1059443590 9:114324656-114324678 CGGTGGCCCAAAGGAGCCCTGGG + Intronic
1061186985 9:129060574-129060596 CCGCAGCCGCAGCGAGCCCTCGG - Exonic
1061656803 9:132098137-132098159 CTGCAGAGCAAAAGAACCCTTGG + Intergenic
1062075473 9:134586331-134586353 CCCCAGCCCAGCAGAGGCCTGGG - Intergenic
1062630485 9:137461058-137461080 CCGCAGGCCGAGAGGGCCCTGGG - Intronic
1188998529 X:36916243-36916265 CCCCACCCCACAAGAGCCCCTGG - Intergenic
1190047966 X:47127757-47127779 GCCCAGCCCAAAAGAGCCCTAGG - Intergenic
1192157522 X:68757581-68757603 CCGCAGGCCTACAGAGACCTGGG + Intergenic
1193803681 X:85968789-85968811 CTTCAGCCCATCAGAGCCCTGGG - Intronic
1195178536 X:102334147-102334169 CCGAGGCCCATAAAAGCCCTGGG - Intergenic
1195180328 X:102352936-102352958 CCGAGGCCCATAAAAGCCCTGGG + Intergenic
1195340964 X:103905619-103905641 CCCCACCCCAAAAGAGGCCCCGG + Intergenic
1196180478 X:112684418-112684440 CCGTAGCCCACAAGAGACCCTGG + Intergenic
1200460926 Y:3453377-3453399 CTGCAGCTCAAGAGAGCACTGGG + Intergenic
1201368440 Y:13234756-13234778 CTGCGGCCCATAAAAGCCCTGGG - Intergenic