ID: 1016752371

View in Genome Browser
Species Human (GRCh38)
Location 6:147645156-147645178
Sequence CAGTAAGATGTCCTGTCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016752371_1016752376 22 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752376 6:147645201-147645223 GTTGATGGCATGTGCAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 181
1016752371_1016752374 18 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752374 6:147645197-147645219 AGCAGTTGATGGCATGTGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 186
1016752371_1016752372 7 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 129
1016752371_1016752375 21 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752375 6:147645200-147645222 AGTTGATGGCATGTGCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016752371 Original CRISPR CAGTAAGATGTCCTGTCGTG TGG (reversed) Intronic