ID: 1016752371

View in Genome Browser
Species Human (GRCh38)
Location 6:147645156-147645178
Sequence CAGTAAGATGTCCTGTCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016752371_1016752372 7 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 129
1016752371_1016752374 18 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752374 6:147645197-147645219 AGCAGTTGATGGCATGTGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 186
1016752371_1016752376 22 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752376 6:147645201-147645223 GTTGATGGCATGTGCAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 181
1016752371_1016752375 21 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752375 6:147645200-147645222 AGTTGATGGCATGTGCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016752371 Original CRISPR CAGTAAGATGTCCTGTCGTG TGG (reversed) Intronic
908551098 1:65209510-65209532 CAGTAAGATCCCCTGTCGGCAGG - Intronic
910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG + Intronic
916468102 1:165092567-165092589 CAGAAAGCTGTCCTGCTGTGGGG + Intergenic
919750339 1:201033992-201034014 CAGGAGGATGACCTGTGGTGAGG + Intergenic
922244707 1:223784446-223784468 CAATAAAATGTCCTGAGGTGGGG + Intronic
1062786797 10:271595-271617 CAGCAGGATGCACTGTCGTGGGG + Intergenic
1067343356 10:45421388-45421410 CAGAAAGAGGTCCTGTGCTGGGG - Intronic
1068180672 10:53514212-53514234 CTGCAATATGTCCTTTCGTGTGG + Intergenic
1077509421 11:2948646-2948668 CAGTAAAAAGTACTGTTGTGAGG - Intronic
1088611429 11:111581131-111581153 CTGTAAGATGTCCTGCTTTGAGG + Intergenic
1106321228 13:28641368-28641390 CAGTAAGCGTTTCTGTCGTGAGG - Intergenic
1106482723 13:30148903-30148925 CAGGAAGCTCTCCTGGCGTGAGG + Intergenic
1112416222 13:99205583-99205605 CATTAAAATGTCCTGGGGTGGGG - Intronic
1113397493 13:109962168-109962190 CAGTTACATGTCCAGTGGTGTGG + Intergenic
1116531518 14:45978649-45978671 CAGTAAAATGTCCAGTGGTGTGG - Intergenic
1121656929 14:95604070-95604092 CAGAAAGCTGCCATGTCGTGAGG + Intergenic
1123958915 15:25373335-25373357 CAGTAATATGGCCTGTCCTAGGG + Intronic
1124252871 15:28118585-28118607 CAGTAAGATGACCTGTGTTCTGG + Intronic
1137025290 16:35468092-35468114 CAGAAAGATGCCCTGACATGTGG + Intergenic
1137647491 16:50088683-50088705 CAGCAAGATGTCCTGTGGGGTGG + Intronic
1139820768 16:69719455-69719477 CAGCAAAATATCCTGTAGTGTGG - Intronic
1152413561 17:80144151-80144173 CAGTAAGTTGTCCTGGGGTGCGG - Exonic
1154131309 18:11738956-11738978 CAGTAAGATGTTATGACGTCGGG - Intronic
1163649956 19:18511575-18511597 CAGACTGATGTCCTGTGGTGTGG - Intronic
1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG + Exonic
926300307 2:11597211-11597233 CTAAAAGATGTCCTGTCTTGTGG - Intronic
927238647 2:20901005-20901027 CAAAAAGATGTCCTGTCCTCTGG - Intergenic
928236363 2:29545039-29545061 CAGTCAGATGCCCTGTGGTTTGG + Intronic
928424953 2:31170246-31170268 CTGGAAGATGTCCTGGTGTGGGG + Intergenic
929620664 2:43350842-43350864 CAGTAAGGTGTCATGTTTTGGGG - Intronic
939784923 2:146497505-146497527 CAGTAAGATGTCATGTTGTGAGG - Intergenic
944821853 2:203440288-203440310 CAGTAAGACGTCCAGCCCTGGGG - Exonic
947076880 2:226354702-226354724 CAGGGAGATTTCCTGTTGTGGGG - Intergenic
948418708 2:237838619-237838641 GAGTAAGATGTTCTGTGTTGGGG + Intronic
1169299143 20:4427139-4427161 CATTAAGATTTCCTGTAGTAAGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1178252478 21:31017488-31017510 CAGTAAGAGGTACTATGGTGGGG + Intergenic
1184871424 22:47241189-47241211 GAGTAGGTTGTCCTGTCGCGGGG - Intergenic
1185223824 22:49642118-49642140 CAGTAGGCTGTCCTGTGATGGGG - Intronic
949168677 3:971849-971871 CAGTGAGATGCCATGTTGTGAGG + Intergenic
957732381 3:84156168-84156190 GAGAAAGATGTGCTGTCATGCGG - Intergenic
968226457 3:196975432-196975454 CAGAAAGATGTTCTGTCTGGGGG + Intergenic
971325721 4:25642091-25642113 CAGAAAAATGTCCTCTTGTGAGG - Intergenic
972076564 4:35096837-35096859 CAGTAAGATGTCATCTCTTGCGG - Intergenic
973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG + Intronic
984260251 4:177436316-177436338 CAGCAATATGTCCTGTCTTATGG + Exonic
985043906 4:185920931-185920953 CAATAAGATGTCCCATCATGAGG + Intronic
985668612 5:1195077-1195099 CAGAAAGATGTCCTCCCTTGAGG - Intergenic
992358267 5:76008547-76008569 CAGCAAGATTTCCTGTAGTATGG - Intergenic
996962029 5:129262828-129262850 CAGGAAGCTTTCCTGTAGTGTGG - Intergenic
999136382 5:149322662-149322684 CAGTGAGAAGTCCCATCGTGTGG + Exonic
1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG + Intronic
1008266982 6:49439735-49439757 CAGTAAGGGGTCCAGTGGTGTGG - Intronic
1008970743 6:57365049-57365071 CAGTAAGCTGTCTTGACTTGAGG - Intronic
1009194555 6:60668454-60668476 CTGTAAGATTTCCTTTTGTGAGG + Intergenic
1010807757 6:80258993-80259015 CTGTAAGATGTCCTGGCATGGGG + Intronic
1012166205 6:95955582-95955604 CAGTGAAATGTTCTGTGGTGAGG + Intergenic
1013921439 6:115409236-115409258 CAGTAAGATATGCTGACTTGTGG - Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1017731752 6:157323391-157323413 AGGTAAGATGTGCTGTGGTGAGG - Exonic
1018169101 6:161130010-161130032 CAGTAAGCTGTGCTGTCTAGTGG + Exonic
1029545893 7:101210433-101210455 GAGGAAGATGCCCTGTAGTGGGG + Exonic
1033302225 7:140196712-140196734 CTGTGAGATGTCCTGTGGAGAGG + Intergenic
1041669046 8:60474935-60474957 CATGAAGTTGTCCTGTCTTGAGG - Intergenic
1046256545 8:111704728-111704750 CAGTAAGATTACCTGCCTTGTGG + Intergenic
1049372713 8:142275367-142275389 CAGAAAGTTGTGCTGCCGTGCGG + Intronic
1049802742 8:144525752-144525774 CAGAAAGGTGTCCTGTCTTTGGG + Exonic
1056374291 9:85991586-85991608 CAGAAAGGTGGCCTGTTGTGGGG + Intronic
1060719956 9:125970104-125970126 CAGTATGAGGTCCCGTCTTGGGG + Intergenic
1060936988 9:127521712-127521734 CAGGAAGGTGTCCTGCCGGGTGG - Intronic
1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG + Intergenic
1186091400 X:6052570-6052592 CTGTCAGCTGTCCTGTGGTGTGG + Intronic
1188826954 X:34847047-34847069 CAGTAAAATTTCCTGTGATGGGG - Intergenic