ID: 1016752372

View in Genome Browser
Species Human (GRCh38)
Location 6:147645186-147645208
Sequence GAAATGCCACTAGCAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016752370_1016752372 8 Left 1016752370 6:147645155-147645177 CCCACACGACAGGACATCTTACT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 129
1016752371_1016752372 7 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 129
1016752367_1016752372 23 Left 1016752367 6:147645140-147645162 CCAGGCTGGGGCAACCCCACACG 0: 1
1: 0
2: 0
3: 24
4: 133
Right 1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 129
1016752369_1016752372 9 Left 1016752369 6:147645154-147645176 CCCCACACGACAGGACATCTTAC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016752372 Original CRISPR GAAATGCCACTAGCAGTTGA TGG Intronic
907045583 1:51298252-51298274 GAAAGCCCACCAGCAGTTGCTGG - Intronic
907642165 1:56201864-56201886 GGAATGCCAGTAGCCATTGAAGG - Intergenic
911043557 1:93610326-93610348 GAAAAGCCACTGGCATTTGCAGG - Intronic
912567609 1:110599555-110599577 GAAATGCCACAAGCAAGTAAAGG + Intronic
912828549 1:112929289-112929311 AAAATGCCACCAGCAGTTGGAGG - Exonic
914461146 1:147886605-147886627 GAAATGCTTCTATCAGTTGCTGG - Intergenic
916727286 1:167534321-167534343 CATGTGCCACCAGCAGTTGAGGG + Intronic
917326652 1:173840040-173840062 GAAATGTCACTAGCATTACAGGG - Intronic
920918859 1:210281151-210281173 GACATGGAACTAGCATTTGAAGG - Intergenic
920960421 1:210658421-210658443 GATATGGAAGTAGCAGTTGATGG - Intronic
921259849 1:213376642-213376664 GAAATGGCAGTAGGAGTTGATGG + Intergenic
921695093 1:218200141-218200163 GAAATGACAGCAGAAGTTGAGGG - Intergenic
923832540 1:237574042-237574064 GAAATTCCACTAGAATTTCAGGG + Intronic
924130569 1:240903318-240903340 GAAATGTGACTAGGAGATGAAGG + Intronic
1063859904 10:10295729-10295751 GAATTGACACTTGCTGTTGAAGG - Intergenic
1064863728 10:19855275-19855297 GAAATGACACCAGCCTTTGATGG - Intronic
1066188101 10:33030339-33030361 GAAATGCCTCAAGCAGTGTATGG + Intergenic
1067167660 10:43878369-43878391 GAAATGCCACTAAATGTTGCAGG - Intergenic
1067972012 10:50982956-50982978 GAAATGCCACAAGTGGCTGAGGG - Intergenic
1072096198 10:92182943-92182965 GAAAATCCACTAGAATTTGATGG + Intronic
1074172722 10:110959444-110959466 GAAATGCTACTGGCATTTAATGG - Intronic
1074866800 10:117548829-117548851 GAAATGCATGTAGCAGTTGTTGG + Exonic
1077577419 11:3395076-3395098 GGAAAGCCGCTTGCAGTTGAGGG - Intergenic
1078897486 11:15609837-15609859 GAAATGTCAATAGCATTTTAAGG - Intergenic
1082854854 11:57797055-57797077 AAAAAGCCCCTAGAAGTTGAAGG - Intronic
1083744715 11:64729010-64729032 GAACTGCCACAAGCAGTGCAAGG - Exonic
1084229374 11:67739861-67739883 GGAAAGCCTCTTGCAGTTGAGGG - Intergenic
1093537078 12:20235089-20235111 GAAATGTCAGAAGCAGTTGAGGG - Intergenic
1095225460 12:39672489-39672511 GAATTGGCAGTGGCAGTTGACGG + Intronic
1097415027 12:59304518-59304540 GAAATGCCATTAGCAATCGTGGG - Intergenic
1098278611 12:68839562-68839584 ATAATGCTACTAGAAGTTGATGG - Exonic
1100395582 12:94183726-94183748 GAAAAGCCACCAGTAGTTGATGG + Intronic
1100762687 12:97826778-97826800 GTAATGGCACTAGGAGGTGAGGG + Intergenic
1102888906 12:116542901-116542923 GATATCCCTCTAGCAGTTAATGG + Intergenic
1104485955 12:129151330-129151352 CAAATATCACCAGCAGTTGAAGG - Intronic
1107929798 13:45297705-45297727 GAAAAGCCTCTAGCAGATGTTGG - Intergenic
1108649591 13:52463670-52463692 GAAACACCAGAAGCAGTTGAGGG + Intronic
1109282515 13:60373064-60373086 CAGATGCCACTAGCACTTTAGGG + Intergenic
1110423267 13:75336993-75337015 AAAATGCAACAAGCAGTGGAAGG - Exonic
1110544626 13:76742814-76742836 GAAATAGCAAAAGCAGTTGAGGG - Intergenic
1111348755 13:86998430-86998452 AGAATGTCAATAGCAGTTGAAGG - Intergenic
1111663688 13:91242043-91242065 GAAATGCCACGAGGAGTGAAAGG + Intergenic
1111843382 13:93477392-93477414 GCAATGCCTCTAGCATGTGAAGG - Intronic
1119271858 14:73312780-73312802 GAAATATCAGAAGCAGTTGAGGG - Intronic
1120312854 14:82853581-82853603 GAAATTCCAATAGGGGTTGAAGG - Intergenic
1125380883 15:39085285-39085307 GACATGCCAGTAGCTGATGAGGG + Intergenic
1131223549 15:90605427-90605449 GAAATGTCTCCAGCAGTTTAAGG + Intronic
1133650104 16:7804815-7804837 GAAATTCCATTAGCAGGCGATGG - Intergenic
1133688690 16:8191666-8191688 GGAAAGGCACTAGCATTTGAAGG + Intergenic
1138775537 16:59718825-59718847 GAAACACCAGAAGCAGTTGAGGG + Intronic
1140851746 16:78941281-78941303 TTAATGCCACTAGCAGTAAAAGG + Intronic
1140921392 16:79542107-79542129 GAATTGTCATTAGCAGTTGGAGG - Intergenic
1140974928 16:80050604-80050626 GAAAAGCCAATAGTAGTAGATGG + Intergenic
1144293102 17:13845531-13845553 GAGATTCCACAAGCAGTTGCGGG + Intergenic
1146620193 17:34391191-34391213 GAAATGCCTTGAGCAATTGAGGG + Intergenic
1149136674 17:53374906-53374928 GAAATTCAATTAGCAGTTGGAGG - Intergenic
1149743406 17:59070310-59070332 GAAATGCCAAAAGAATTTGAAGG - Intronic
1153032280 18:725926-725948 GAAATACAACTAGAAGTTGTTGG + Intronic
1156653269 18:39252418-39252440 GCAATGGCAGTAGCAGTGGAAGG - Intergenic
1159318297 18:66810133-66810155 GAAATGCCTCTTGGAGCTGAGGG + Intergenic
1159810005 18:73006815-73006837 GAAATGACAATGGCAGTTAAGGG + Intergenic
1159810800 18:73016134-73016156 GAAATGCCTCTCACAGGTGAAGG - Intergenic
1159875119 18:73802248-73802270 GAAATTGCATTAGAAGTTGAAGG - Intergenic
926173413 2:10568642-10568664 GAAAAGCCACCACCAGGTGAGGG + Intergenic
937692736 2:124774262-124774284 GAAATGCCACCAGCATTCAATGG + Intronic
943043126 2:182826640-182826662 GAAATGAGACCAGCAGTTTAAGG + Intergenic
946911814 2:224469376-224469398 GAAATCCCACTAATAGTTAATGG - Intergenic
947108781 2:226696379-226696401 GAAAAGCCAACAGTAGTTGAGGG - Intergenic
948649815 2:239434852-239434874 GCATTCCCACTAGCAGTAGATGG + Intergenic
1169553201 20:6722440-6722462 GAAATGCCACCAGCAATTATAGG + Intergenic
1170485827 20:16815558-16815580 GAAACACCAGGAGCAGTTGATGG + Intergenic
1173332149 20:42084540-42084562 GTACTGCCACTAGCCTTTGAGGG + Intronic
1173881751 20:46418982-46419004 GAAATGCTACTGGCATTTAATGG - Intronic
1175171562 20:57084898-57084920 GAGAAGCCACTAGCATTTGGTGG + Intergenic
1177867708 21:26532491-26532513 GAAATGTCAGAAGCAGTGGAGGG - Intronic
1182584498 22:31336445-31336467 GAATTGCCACTATCATTTAATGG - Intronic
1185116794 22:48942422-48942444 GAAAAGCCACTGGAAGTGGAGGG + Intergenic
1185239799 22:49736560-49736582 GAAATTCCTCTAGAATTTGAGGG - Intergenic
1185268979 22:49919515-49919537 GAAAAGCCACTGTCTGTTGAGGG - Intronic
951383563 3:22016232-22016254 GAGATGCCACTAGCATTTGGTGG + Intronic
952950936 3:38524612-38524634 GCAAAGCCACTAGTAGCTGAGGG - Exonic
954134341 3:48575245-48575267 GAAATGCAAATAGCGGGTGAGGG + Intronic
954503849 3:51049397-51049419 GAAATATCAGGAGCAGTTGAGGG + Intronic
956487705 3:69739834-69739856 GAACTGCCCCTCGCAGTTGGGGG + Intronic
957782546 3:84837667-84837689 GAAATGCCAACAGCAGATAAAGG - Intergenic
961586198 3:127927956-127927978 GACATGCCAATTGCAGTGGAAGG - Exonic
962426430 3:135272779-135272801 GAAATGCCATGAGAGGTTGAGGG + Intergenic
962625911 3:137225663-137225685 GAAATGCCTTTAGAAGTTGCAGG + Intergenic
963918426 3:150882477-150882499 GAAATACTGTTAGCAGTTGATGG - Intronic
964770448 3:160219358-160219380 GAATTGCCACAAACAGTAGATGG + Intergenic
968138876 3:196239708-196239730 GAAATACCACTTGCAGGAGAGGG - Exonic
972632131 4:40851378-40851400 AAAAGGTCACTAGCAGATGATGG + Intronic
976380362 4:84391812-84391834 GAAATGACACCAGCAGTTCTAGG + Intergenic
976880201 4:89912724-89912746 GAAAGGCCATTAGCAGTGGTGGG + Intronic
977926529 4:102706016-102706038 GAAATGGCAGTAGCAGTGGCAGG - Intronic
980154863 4:129092232-129092254 GAAATGGCAAGTGCAGTTGAAGG - Intronic
980973323 4:139587220-139587242 GAAAGGCCACCAGCTCTTGACGG + Intronic
981533438 4:145775183-145775205 GAAATGTCTCTAGCAGTGGGTGG - Intronic
983453354 4:167933330-167933352 GAAATGATATTAGGAGTTGATGG - Intergenic
983657211 4:170095253-170095275 GAAATGTCAGAAGCAGTTGAAGG + Intergenic
984071927 4:175125665-175125687 GAAATGCCACTAGGTGATGCTGG - Intergenic
984535122 4:180964823-180964845 ATAGTGCCACTTGCAGTTGAAGG - Intergenic
989723714 5:44561358-44561380 GAGAAGCCTCTAGCAGCTGAGGG + Intergenic
990624030 5:57591648-57591670 GAAATGCCTTTACCAGTTTATGG - Intergenic
993242305 5:85406402-85406424 TAAATGTCACTAGCATTTAAAGG + Intergenic
994044305 5:95291031-95291053 AAAAGGCCACTAGCACTAGATGG + Intergenic
997787707 5:136728747-136728769 GAAAAGCCAAAAGCAGTTGGAGG + Intergenic
1011130790 6:84050227-84050249 GAAGTGCCAGTAGAAGGTGATGG + Intronic
1014890865 6:126844360-126844382 GAAATATCAGAAGCAGTTGAGGG + Intergenic
1016582237 6:145641680-145641702 CAAATACAACTAGCATTTGATGG + Intronic
1016752372 6:147645186-147645208 GAAATGCCACTAGCAGTTGATGG + Intronic
1020313049 7:6883898-6883920 GGAAAGCCTCTTGCAGTTGAGGG - Intergenic
1021043457 7:15892095-15892117 GAATTGCCAGTAGCATTTAAGGG + Intergenic
1027499714 7:78933913-78933935 GAAACACCAGAAGCAGTTGAGGG - Intronic
1028156701 7:87437808-87437830 GAAAAGCCATTAGCAGCTTAGGG - Intronic
1030840155 7:114341572-114341594 CAAATGCCAGTAGGTGTTGATGG + Intronic
1030909511 7:115229243-115229265 GAAATGTCAGTGGAAGTTGATGG + Intergenic
1033714446 7:143985227-143985249 GAAATGCTAAGAGAAGTTGATGG - Intergenic
1034323362 7:150205945-150205967 GAAATCCCACTAGGAATTAATGG + Intergenic
1034769836 7:153763244-153763266 GAAATCCCACTAGGAATTAATGG - Intergenic
1035064196 7:156093627-156093649 GAAATGTCATTAGCAGCTCATGG + Intergenic
1037441968 8:18925836-18925858 GAAACACCAGTAGCAGTTGAGGG - Intronic
1040074099 8:43212081-43212103 AAAATGCCACAAGCAGCAGAGGG + Intergenic
1040460084 8:47639173-47639195 GAAATGACACTAACAGTACATGG + Intronic
1046830433 8:118739893-118739915 GAAATTCCAGTAAAAGTTGATGG - Intergenic
1048511774 8:135069652-135069674 GAAAATCCATTAGCAGTTGAGGG - Intergenic
1048811124 8:138287390-138287412 CAACTTCCACTAGCAGTTTATGG - Intronic
1051038712 9:12779996-12780018 GAACTGCCATGAGCAGTTAAAGG + Intronic
1052032837 9:23647784-23647806 GAATTTACACTAACAGTTGATGG + Intergenic
1052365142 9:27603975-27603997 AAAATTCCACTAGCATGTGAAGG - Intergenic
1186160093 X:6768220-6768242 GGGATGGCACTGGCAGTTGATGG + Intergenic
1192141689 X:68651825-68651847 GAAATGCCACGAACATTTGGTGG + Intronic
1192730191 X:73795324-73795346 GAAAGACTACCAGCAGTTGATGG + Intergenic
1193498168 X:82238819-82238841 GCAATGCCACTACCAGTGGCTGG + Intergenic
1193715189 X:84928314-84928336 GCAATGCCACTACCAGTGGCTGG + Intergenic
1195230546 X:102842531-102842553 GAAATGCCACCAGCACCTCAGGG + Intergenic
1198047470 X:132917052-132917074 GAAATGCCAGTATTAATTGATGG + Intronic
1199104646 X:143849751-143849773 GAAACACCAGAAGCAGTTGAAGG - Intergenic