ID: 1016752374 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:147645197-147645219 |
Sequence | AGCAGTTGATGGCATGTGCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 197 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 186} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016752370_1016752374 | 19 | Left | 1016752370 | 6:147645155-147645177 | CCCACACGACAGGACATCTTACT | 0: 1 1: 0 2: 0 3: 2 4: 49 |
||
Right | 1016752374 | 6:147645197-147645219 | AGCAGTTGATGGCATGTGCAAGG | 0: 1 1: 0 2: 0 3: 10 4: 186 |
||||
1016752371_1016752374 | 18 | Left | 1016752371 | 6:147645156-147645178 | CCACACGACAGGACATCTTACTG | 0: 1 1: 0 2: 1 3: 5 4: 66 |
||
Right | 1016752374 | 6:147645197-147645219 | AGCAGTTGATGGCATGTGCAAGG | 0: 1 1: 0 2: 0 3: 10 4: 186 |
||||
1016752369_1016752374 | 20 | Left | 1016752369 | 6:147645154-147645176 | CCCCACACGACAGGACATCTTAC | 0: 1 1: 0 2: 0 3: 6 4: 45 |
||
Right | 1016752374 | 6:147645197-147645219 | AGCAGTTGATGGCATGTGCAAGG | 0: 1 1: 0 2: 0 3: 10 4: 186 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016752374 | Original CRISPR | AGCAGTTGATGGCATGTGCA AGG | Intronic | ||