ID: 1016752375

View in Genome Browser
Species Human (GRCh38)
Location 6:147645200-147645222
Sequence AGTTGATGGCATGTGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016752369_1016752375 23 Left 1016752369 6:147645154-147645176 CCCCACACGACAGGACATCTTAC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1016752375 6:147645200-147645222 AGTTGATGGCATGTGCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 164
1016752370_1016752375 22 Left 1016752370 6:147645155-147645177 CCCACACGACAGGACATCTTACT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1016752375 6:147645200-147645222 AGTTGATGGCATGTGCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 164
1016752371_1016752375 21 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752375 6:147645200-147645222 AGTTGATGGCATGTGCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016752375 Original CRISPR AGTTGATGGCATGTGCAAGG AGG Intronic
904350618 1:29903111-29903133 AATAGATGGCCTGAGCAAGGCGG + Intergenic
905982784 1:42245877-42245899 AGGTCATGTCATGTGCAAAGAGG - Intronic
906030765 1:42718318-42718340 AGTAGATGGCATGGGGCAGGTGG - Intergenic
906572669 1:46857598-46857620 AGTTGATGGCATTGCCAAAGGGG + Intergenic
906584054 1:46961119-46961141 AGTTGGTGGCAGGTGTGAGGTGG + Intergenic
907227032 1:52957397-52957419 AGCTGGAGGCATGGGCAAGGGGG - Intronic
908098540 1:60766333-60766355 AGTTGTTGGCATGGGGAAGCTGG + Intergenic
909232408 1:73106446-73106468 AGCTGGAGGCATGGGCAAGGGGG - Intergenic
910436030 1:87207202-87207224 AGTTTCTGGCTTGAGCAAGGAGG - Intergenic
915375875 1:155395135-155395157 AGTTGATGGCCTGGGCAACTTGG - Intronic
915475316 1:156149734-156149756 AGGTGGTGACATGTGCACGGTGG + Intronic
915619928 1:157074859-157074881 AGCTGGAGGCATGGGCAAGGGGG - Intergenic
915914662 1:159933809-159933831 GGTTGAGGGCAGGGGCAAGGAGG - Intronic
916127656 1:161585712-161585734 AGTTAAGGGGATTTGCAAGGAGG + Intronic
916137574 1:161667516-161667538 AGTTAAGGGGATTTGCAAGGAGG + Intronic
916996573 1:170307945-170307967 AGTTAATGGCATGCCCAAGGTGG - Intergenic
917728988 1:177855315-177855337 AGTTGGTGGGATGTGGAAGTAGG + Intergenic
919571105 1:199249047-199249069 AGGTGAGGGAATCTGCAAGGTGG + Intergenic
922001427 1:221482524-221482546 AGTTGAGGGCATGTGGAGGATGG - Intergenic
922940645 1:229462169-229462191 AGTTGTTGGGCTGGGCAAGGTGG - Intronic
923453485 1:234141885-234141907 AGTGGATGGCATGAGTGAGGAGG - Intronic
923572162 1:235126220-235126242 AATTGCTGGAATGTGGAAGGTGG - Intronic
1063306980 10:4911349-4911371 AGTTCATGCCATGTGCAAGGGGG + Intergenic
1063307467 10:4918368-4918390 AGTTCATGCCATGTGCAAGGGGG - Intergenic
1065488353 10:26255880-26255902 GTGTGATGGCAGGTGCAAGGAGG + Intronic
1065826426 10:29576274-29576296 ACTTGATGGGATCTGCAAGAGGG + Intronic
1067103518 10:43350138-43350160 AGTTGAAGGCCTGGGGAAGGAGG + Intergenic
1068201580 10:53790126-53790148 TGTTAATGGCATGGGAAAGGAGG + Intergenic
1068232816 10:54192835-54192857 AGATGATGCCATGTACATGGAGG - Intronic
1069117152 10:64521794-64521816 AGTTTATCTCATTTGCAAGGAGG + Intergenic
1069897179 10:71687090-71687112 CGTTGTTCTCATGTGCAAGGAGG + Intronic
1074983283 10:118636526-118636548 AGGTGATGGCATGTACAGGTGGG - Intergenic
1075060656 10:119254583-119254605 AGTTGATGGCTGGGGCACGGAGG + Intronic
1078048318 11:7938828-7938850 AGTTGATGGCATCTTCAGGATGG + Exonic
1085379438 11:76100751-76100773 AGATGATGGAAGGTGGAAGGAGG - Intronic
1086520814 11:87665862-87665884 AGTTGAAGCCATGAGCAAGTAGG - Intergenic
1087016660 11:93560688-93560710 AATTGATGGCCTGAGAAAGGAGG + Intergenic
1088881871 11:113979162-113979184 AGGGGCTGGCATGTGCAGGGTGG + Intronic
1091197717 11:133746269-133746291 AGATGATGGCATGAGCACTGAGG - Intergenic
1091322620 11:134662867-134662889 AGCTGTGGGCATGTGCAAGGGGG + Intergenic
1092302067 12:7260815-7260837 TGCTGATGGCTTCTGCAAGGAGG + Intergenic
1095960363 12:47830630-47830652 TGTTGGTGGGATGAGCAAGGGGG + Intronic
1096626128 12:52897253-52897275 AGCTGGAGGCATGGGCAAGGGGG + Intronic
1097968730 12:65609527-65609549 AATTGATCACATGTGGAAGGAGG + Intergenic
1098264807 12:68707220-68707242 AGCTGTAGGCATGGGCAAGGGGG - Intronic
1100282049 12:93127469-93127491 TGTAGATGGCATGAGCAATGTGG + Intergenic
1104725104 12:131071046-131071068 AGGTGGAGCCATGTGCAAGGAGG + Intronic
1104725122 12:131071126-131071148 AGGTGGAGCCATGTGCAAGGAGG + Intronic
1104725140 12:131071207-131071229 AGGTGGAGCCATGTGCAAGGAGG + Intronic
1104725158 12:131071287-131071309 AGGTGGAGCCATGTGCAAGGAGG + Intronic
1105550642 13:21392447-21392469 AGCTGAAGGCATGGGTAAGGTGG - Intronic
1109692158 13:65908625-65908647 AGTTGATGGCATTTGCAGGTAGG + Intergenic
1109816095 13:67586885-67586907 AGATCATGGCATATGCAAAGAGG + Intergenic
1111664037 13:91244985-91245007 AGTTCACCCCATGTGCAAGGAGG - Intergenic
1116326789 14:43540697-43540719 AGCTGGAGGCATGGGCAAGGGGG + Intergenic
1117384535 14:55197678-55197700 ATATGCTGGCATGTGCATGGTGG - Intergenic
1120442768 14:84560456-84560478 AGATAGTGGCATGTGCATGGAGG + Intergenic
1122302158 14:100737304-100737326 AATTGTTGGCATGTGTCAGGCGG + Exonic
1202848440 14_GL000225v1_random:1071-1093 AGGTGGTGGCCTGTGCAACGTGG + Intergenic
1125840915 15:42800794-42800816 AGCTGGAGGCATGGGCAAGGGGG + Intronic
1127278925 15:57472233-57472255 AGGAAATAGCATGTGCAAGGGGG + Intronic
1127716727 15:61655694-61655716 ATTTGATGCCATGTGCTGGGTGG - Intergenic
1129716877 15:77857428-77857450 ACGTGGTGGGATGTGCAAGGTGG + Intergenic
1129889784 15:79064302-79064324 AGTGGAGGGCATGGGAAAGGAGG - Intronic
1130374931 15:83320597-83320619 AGTTGATGATATCTGCACGGTGG + Intergenic
1133116588 16:3581065-3581087 AGTAAAGGGCAGGTGCAAGGTGG + Intergenic
1133594970 16:7282263-7282285 AGTAAATGGCATTTGCAAAGGGG + Intronic
1134340716 16:13342769-13342791 AGTAGATGGCATTTGGAAGCAGG - Intergenic
1136183939 16:28573983-28574005 AGGTGCGGGCATGTGCAAGGCGG + Intronic
1138339678 16:56280552-56280574 TGATGATGGCATGTGCAGAGTGG + Intronic
1140753613 16:78048304-78048326 AGCTGGAGGCATGGGCAAGGGGG + Intronic
1141186667 16:81792392-81792414 AATTGCTTGAATGTGCAAGGCGG + Intronic
1142510550 17:389967-389989 AGGTGCTGGCAGGTGGAAGGAGG - Intergenic
1143625051 17:8104926-8104948 AGTTGTTGGCAAGTGGGAGGTGG - Intronic
1147349941 17:39834783-39834805 AGCTGGAGGCATGGGCAAGGGGG + Intronic
1149870988 17:60181514-60181536 AGTCGAGGGCATGTGCTGGGGGG - Exonic
1152905057 17:82965476-82965498 AGATGCTGGCAGGTGCCAGGAGG + Intronic
1153480410 18:5542823-5542845 AGTTCATGGCTTCTGCAATGCGG - Intronic
1162349129 19:10138225-10138247 AGTAGATAGCATGTGCAGAGCGG - Intronic
926292417 2:11541429-11541451 AGTGGATGGCAAGTGAGAGGGGG + Intronic
926409057 2:12582723-12582745 ACTTGGTGGCATCTGCAATGTGG - Intergenic
928790926 2:34952126-34952148 ATTTGAGGACATGTGCAAAGTGG - Intergenic
930555791 2:52894365-52894387 TGCTGGTGGCATGTGCAAGTAGG + Intergenic
935160530 2:100525987-100526009 AGCTGTTCGCATGTGAAAGGAGG - Intergenic
935681460 2:105641840-105641862 AAAAGATGGAATGTGCAAGGAGG + Intergenic
940515307 2:154677083-154677105 TGTTGATGGCATTTGGAAGTGGG + Intergenic
940789723 2:158019294-158019316 AGTTGGTGGGATATGAAAGGAGG + Intronic
941068527 2:160930183-160930205 TGTTGATGGGATGTGGAAAGAGG - Intergenic
945197088 2:207246856-207246878 AGTAGATGGCATGTTCAGAGCGG - Intergenic
1168997263 20:2142769-2142791 AGATGATTCCATGTGCAACGAGG + Intronic
1169273959 20:4220916-4220938 AGGTGATGGGGTGTGCACGGAGG + Exonic
1169277315 20:4242738-4242760 AGTGGATGGCATTTGGAAGGTGG + Intronic
1170695762 20:18657148-18657170 AGGTGATGGGATGTGCAAACTGG - Intronic
1170750585 20:19141157-19141179 AGTTGAGGGCCTCTCCAAGGAGG + Intergenic
1171076224 20:22127099-22127121 AGCTTCTGGCATGTGCATGGTGG - Intergenic
1173859452 20:46273135-46273157 AGTTCATGGCCTGAACAAGGTGG - Intronic
1174131852 20:48350491-48350513 AGTTGATGGCATGTGGGTGGAGG + Intergenic
1174185102 20:48700967-48700989 AGTTTTTGGCATGTGGCAGGAGG - Intronic
1182775435 22:32827996-32828018 ATATGATGGCAGGTGCTAGGAGG - Intronic
1183316135 22:37137809-37137831 AGGTGGTAGCATGTGCCAGGAGG - Intronic
1183540598 22:38427301-38427323 GCTTTATGGCATGGGCAAGGAGG - Exonic
1184055306 22:42043582-42043604 AGTTGTAGGCATGTGCATGGAGG + Intronic
949380103 3:3434713-3434735 AGTTGCTTGCATGTGCACGATGG - Intergenic
950803330 3:15573844-15573866 AAATGATGGCTTCTGCAAGGAGG + Intronic
952611431 3:35215542-35215564 AGTTGGAGGCATGGGCAAAGGGG + Intergenic
952992414 3:38843211-38843233 ACTGGATAGAATGTGCAAGGTGG - Intergenic
954140543 3:48602915-48602937 AGGAGATGGCAGGAGCAAGGGGG - Intronic
954640062 3:52092516-52092538 TGTTGCTGCCATGTGCCAGGTGG + Intronic
956521886 3:70113738-70113760 AGTTGATGGCATTTGGAGGTGGG + Intergenic
956543473 3:70371761-70371783 AGTTCATGTCATCTGCAAAGAGG + Intergenic
959626599 3:108458882-108458904 AGATGTTGGCATTGGCAAGGAGG + Intronic
959783647 3:110267160-110267182 AGTTGATGGAATCTGCATGGAGG - Intergenic
959893238 3:111580013-111580035 AGTTGCTTGCTTGAGCAAGGTGG + Intronic
962712697 3:138101298-138101320 AGCTGGAGGCATGGGCAAGGGGG + Intronic
963755494 3:149231337-149231359 AGTGGATGGCAAGAGAAAGGAGG + Intergenic
964632938 3:158832638-158832660 AGTTGATGGGTTGGGCAAGCTGG + Intergenic
964667758 3:159192607-159192629 AGTTGATTGCCTGTAGAAGGGGG + Intronic
966641701 3:182198459-182198481 AGTTGTTGGCATGTGCCACCAGG - Intergenic
973003704 4:44984532-44984554 AGTTGATGAAATGTCCAAGTGGG - Intergenic
973534548 4:51867851-51867873 AGTTGATGGCATCAGGAAGCAGG - Intronic
975002799 4:69245828-69245850 AGTTCATGTCATCTGCAAAGAGG + Intergenic
975010900 4:69349814-69349836 AGTTCATGTCATCTGCAAAGAGG + Intronic
975975971 4:80097206-80097228 AGGTGATGGCATTTGAAAGGTGG - Intronic
977300086 4:95257510-95257532 AGTTGACGGTATGTGGAAAGGGG + Intronic
978047516 4:104149987-104150009 AGGTGATGGAATGTGCATGAGGG + Intergenic
995416950 5:111923103-111923125 AATTGGTGGCATGAGCATGGAGG + Intronic
995801971 5:116006896-116006918 AATTGATAGCAAGAGCAAGGTGG - Intronic
996548316 5:124704676-124704698 AGTTGATGCCATGAGGAATGTGG - Intronic
998029738 5:138855591-138855613 AGTTGCTGGCACTTGCCAGGAGG + Intronic
998394695 5:141811347-141811369 AGCTGGTGGAAGGTGCAAGGTGG - Intergenic
998513125 5:142730152-142730174 GGCTGATGTCATGTGCATGGTGG - Intergenic
1003478771 6:6512034-6512056 AGTTGGTGGCATGAACAAGTGGG - Intergenic
1004350967 6:14890169-14890191 AGTTGAAGGTGTGGGCAAGGGGG + Intergenic
1004880337 6:20001422-20001444 AGTTGGTGCCATGTGTAATGGGG - Intergenic
1004962637 6:20808456-20808478 AGTTGATTGGATGTGCAAAGGGG + Intronic
1005633178 6:27728241-27728263 ATTTGATGGGATTTGGAAGGAGG - Intergenic
1005765366 6:29005747-29005769 CGTTTATGGCCTGTGCAAAGGGG + Intergenic
1006400034 6:33812482-33812504 AGAGGATGGCATGGGCATGGAGG - Intergenic
1010175591 6:73024334-73024356 AGTTGATGGCATATCAAGGGAGG - Intronic
1011117108 6:83905877-83905899 TGCAGATGGCATGTGCAAGGAGG + Intronic
1012414128 6:98994072-98994094 CCTTGATGTCATGGGCAAGGAGG - Intergenic
1015094711 6:129401307-129401329 AGTTGATTTCATCTGCAAGACGG - Exonic
1015539081 6:134296816-134296838 AGCTGGAGGCATGGGCAAGGGGG + Intronic
1016231324 6:141808558-141808580 AGTTCATGGCATGCACAAGTAGG + Intergenic
1016752375 6:147645200-147645222 AGTTGATGGCATGTGCAAGGAGG + Intronic
1017947633 6:159108624-159108646 AGATGATGTCATGTTCCAGGAGG + Intergenic
1018317375 6:162569884-162569906 AGCTGAAGGCATGGGCAAGGTGG - Intronic
1019020477 6:168913723-168913745 ACTGCATGGCATGTGGAAGGCGG - Intergenic
1020982929 7:15094683-15094705 AGTTAAGGGTATATGCAAGGGGG + Intergenic
1021547418 7:21830647-21830669 AGTTTATGGCTTGGCCAAGGTGG - Intronic
1024569191 7:50710040-50710062 GGTTGATGGGGTGTGCATGGTGG - Intronic
1025630130 7:63263971-63263993 AGTAGATGGCATGGTAAAGGAGG - Intergenic
1027012028 7:74753919-74753941 AGTTGATGGCATGCCCCCGGGGG + Intronic
1035552415 8:539169-539191 ATGTGATGGCATGTGCAGGTGGG + Intronic
1039002887 8:33001264-33001286 ATTTTCTGGCAGGTGCAAGGAGG - Intergenic
1039745637 8:40423734-40423756 AGTTGATGTGATGTTCATGGAGG + Intergenic
1039916540 8:41864508-41864530 AGGGGATCTCATGTGCAAGGAGG - Intronic
1040093025 8:43418305-43418327 AGTTTATGTCATCTGCAAAGAGG + Intergenic
1040641747 8:49342881-49342903 AGTTGATGGCAAGTGTAAACTGG - Intergenic
1041781259 8:61579824-61579846 AGCTGGAGGCATGGGCAAGGGGG - Intronic
1041872620 8:62652146-62652168 AGATGATGGCATTTGGAAGTGGG - Intronic
1042392821 8:68255770-68255792 AATTGATGGCAATTGCAAGAAGG + Intergenic
1044181557 8:89201972-89201994 ATTTGATGCCATGCACAAGGAGG - Intergenic
1044711155 8:95059427-95059449 AGTTGAATGAATGTGCAATGTGG + Intronic
1047745224 8:127839955-127839977 AGTTGATGGCCAGTGCACTGGGG + Intergenic
1048201351 8:132376883-132376905 AGTGGATGGCAGTTGCATGGTGG - Intronic
1053086139 9:35224559-35224581 AGATCATGTCATGTGCAAAGAGG + Intronic
1055433258 9:76266549-76266571 AGATTCTGGCATGTGCATGGAGG - Intronic
1057943780 9:99306766-99306788 AGCTGGAGGCATGGGCAAGGAGG - Intergenic
1058839514 9:108892453-108892475 GGTTAATGGCATGGGCAGGGTGG + Intronic
1059038745 9:110789235-110789257 AGATGATGGCATGGGCCAGGTGG + Intronic
1059753050 9:117267024-117267046 ACTTGATGACTTGTACAAGGTGG - Intronic
1188208492 X:27389844-27389866 AGTTGTTGGCATGGGAAAGCTGG - Intergenic
1192919777 X:75694530-75694552 AGTTGCTGGCGTGTGCATGTGGG + Intergenic
1193071772 X:77314117-77314139 AGGTCATGTCATCTGCAAGGAGG - Intergenic
1194662532 X:96642860-96642882 AGTTCTTGCCATTTGCAAGGGGG - Intergenic
1196936405 X:120735106-120735128 AGTTCATGACATCTGAAAGGAGG - Intergenic
1198057491 X:133009378-133009400 AGATGTTGGTATCTGCAAGGTGG + Intergenic
1200886160 Y:8272604-8272626 ATTGGATGGCCTGGGCAAGGTGG - Intergenic
1201723347 Y:17128506-17128528 AGTTCATGCCATTTGCAGGGAGG + Intergenic