ID: 1016752376

View in Genome Browser
Species Human (GRCh38)
Location 6:147645201-147645223
Sequence GTTGATGGCATGTGCAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016752371_1016752376 22 Left 1016752371 6:147645156-147645178 CCACACGACAGGACATCTTACTG 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1016752376 6:147645201-147645223 GTTGATGGCATGTGCAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 181
1016752370_1016752376 23 Left 1016752370 6:147645155-147645177 CCCACACGACAGGACATCTTACT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1016752376 6:147645201-147645223 GTTGATGGCATGTGCAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 181
1016752369_1016752376 24 Left 1016752369 6:147645154-147645176 CCCCACACGACAGGACATCTTAC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1016752376 6:147645201-147645223 GTTGATGGCATGTGCAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016752376 Original CRISPR GTTGATGGCATGTGCAAGGA GGG Intronic
902821461 1:18945824-18945846 GTGGATGGCAAGTGCGATGATGG - Intronic
903640241 1:24854629-24854651 GTTGATGGCATTTGGAGGGGAGG + Intergenic
905704874 1:40047845-40047867 GTAGAGGACATGTGTAAGGAGGG + Intronic
905982783 1:42245876-42245898 GGTCATGTCATGTGCAAAGAGGG - Intronic
906633419 1:47391321-47391343 AGTGGGGGCATGTGCAAGGAAGG + Intergenic
908110240 1:60889482-60889504 GTCCATGGCATGTAAAAGGATGG - Intronic
909304522 1:74056430-74056452 GATCATGTCATCTGCAAGGAGGG - Intronic
910333674 1:86104844-86104866 GCTGCTGGCATGTGCAAACAAGG - Intronic
911386656 1:97183908-97183930 GAGGATGGAAGGTGCAAGGAGGG - Intronic
912405956 1:109437819-109437841 GTTGATGGCATCTGGAAGTAAGG - Intergenic
917499876 1:175576443-175576465 CATGATGGCCTGTGCAAGGGTGG - Intronic
917637757 1:176953698-176953720 GTAGATAGCATGTGGAGGGAAGG + Intronic
918562381 1:185885058-185885080 AATGAAGGCATGTCCAAGGATGG - Intronic
919615679 1:199805874-199805896 TTTGATGTCAGGTGCCAGGATGG - Intergenic
921882413 1:220270438-220270460 GTTTATGGTATGTCCAAGTAAGG - Intronic
922145808 1:222943069-222943091 GGTGATGGTATGGGCAAGGATGG - Exonic
922236917 1:223728854-223728876 GTTGCTGGCTTGTGCAAGTCAGG - Intronic
922307834 1:224359358-224359380 GTTGTGGGCAGGTGAAAGGAGGG + Intronic
923453484 1:234141884-234141906 GTGGATGGCATGAGTGAGGAGGG - Intronic
923470872 1:234289613-234289635 GTTCATGCCATGTGCAAGTATGG + Intronic
924071916 1:240289203-240289225 GTTCATGGCTTATGAAAGGAAGG + Intronic
1063290108 10:4736235-4736257 TCTGCTGGCATGTCCAAGGATGG + Intergenic
1068232815 10:54192834-54192856 GATGATGCCATGTACATGGAGGG - Intronic
1068670659 10:59719443-59719465 ATTGATGTGATGTGGAAGGAGGG - Intronic
1072250692 10:93580109-93580131 GTGGATGGAGTGTGCAAGCAGGG + Intronic
1075180966 10:120210765-120210787 AGTGATGGCATTAGCAAGGATGG - Intergenic
1075658551 10:124177449-124177471 GCTGGTGGCATGTGGCAGGAAGG + Intergenic
1077260986 11:1620590-1620612 GTTGCTGGAAGGTGCTAGGATGG - Intergenic
1081778614 11:45694443-45694465 GTTGATGGGACGGGGAAGGAAGG - Intergenic
1083488185 11:62996469-62996491 GGGGATGGCATGTTCAAGGCTGG + Intronic
1084798926 11:71528352-71528374 GTTGCTGGAAGGTGCTAGGATGG + Exonic
1085379437 11:76100750-76100772 GATGATGGAAGGTGGAAGGAGGG - Intronic
1085580808 11:77648756-77648778 GTTGAGGGCAAGGGCAAGAAGGG + Intergenic
1086520813 11:87665861-87665883 GTTGAAGCCATGAGCAAGTAGGG - Intergenic
1087248558 11:95870380-95870402 GCAGATGGCATGGTCAAGGAGGG + Intronic
1087685245 11:101255308-101255330 GTTGAGTGCATGTGCTGGGATGG + Intergenic
1088230433 11:107668697-107668719 TTTTATGCCATGTGCCAGGACGG + Intergenic
1088469267 11:110176418-110176440 GATGATGGGATGTGGAAGGCAGG - Intronic
1088601239 11:111478096-111478118 GGTGATGGCAGCTGCAGGGAGGG - Intronic
1090925259 11:131244032-131244054 GTTGGTGACAGGAGCAAGGAAGG - Intergenic
1091529234 12:1339016-1339038 GTTGCTGGCATGTGCAAATGAGG - Intronic
1092333689 12:7608816-7608838 GTTGCTGGCATATGCAAGTGAGG + Intergenic
1092916628 12:13195205-13195227 GATGTTGGCATGTGGATGGATGG - Intergenic
1093394320 12:18662124-18662146 GAAGATGGAAAGTGCAAGGAGGG + Intergenic
1095960364 12:47830631-47830653 GTTGGTGGGATGAGCAAGGGGGG + Intronic
1097312448 12:58135142-58135164 GTTGATGGCATGTGTTAAAAAGG - Intergenic
1097968731 12:65609528-65609550 ATTGATCACATGTGGAAGGAGGG + Intergenic
1100727766 12:97427094-97427116 GTTGAAGCCATGTGCTGGGATGG + Intergenic
1104725176 12:131071368-131071390 GGTGGAGCCATGTGCAAGGAAGG + Intronic
1104968386 12:132520148-132520170 GTTGCTGGAGGGTGCAAGGAGGG - Intronic
1104968406 12:132520218-132520240 GTTGCTGGAGGGTGCAAGGAGGG - Intronic
1109369959 13:61411149-61411171 GTTGATGGCAGTTCCAATGAAGG - Exonic
1109621373 13:64911450-64911472 GCTGCTGGCATGTGCAAGCAAGG + Intergenic
1109816096 13:67586886-67586908 GATCATGGCATATGCAAAGAGGG + Intergenic
1111407564 13:87828992-87829014 GTTGATAGAAGGTGCAAGGCAGG + Intergenic
1112018929 13:95354717-95354739 GTTGATACAATGTGCATGGAGGG + Intergenic
1114668252 14:24394114-24394136 CTTGAAGCCAAGTGCAAGGAAGG - Intergenic
1117357659 14:54941109-54941131 GTTTTTGTCATGTGCAAGGAAGG - Exonic
1119838286 14:77770790-77770812 GTTGATGGCATTTTGAAGGGTGG - Intergenic
1124136127 15:27037891-27037913 GTTGGTGGCATGTGGAAAGTAGG - Intronic
1127681667 15:61303832-61303854 GTTTCTGGCAGGAGCAAGGAAGG - Intergenic
1131754717 15:95547313-95547335 ACTGATGGCATGGGCAAAGATGG - Intergenic
1132911856 16:2317811-2317833 CATGATGGCATGTGCCAGGCTGG + Intronic
1133525529 16:6601731-6601753 GTTGAGGTCAAGAGCAAGGAAGG + Intronic
1134511864 16:14854978-14855000 GTGGAGGGAATGAGCAAGGAAGG + Intronic
1134699507 16:16253477-16253499 GTGGAGGGAATGAGCAAGGAAGG + Intronic
1134972322 16:18541194-18541216 GTGGAGGGAATGAGCAAGGAAGG - Intronic
1136183940 16:28573984-28574006 GGTGCGGGCATGTGCAAGGCGGG + Intronic
1136289689 16:29264183-29264205 GTGCATGGCAGGAGCAAGGAGGG - Intergenic
1137965632 16:52930246-52930268 GTTGAAGGCAGGGGGAAGGAGGG - Intergenic
1137975061 16:53024247-53024269 GTGGATTGCATGTGGGAGGATGG + Intergenic
1138056661 16:53841536-53841558 GTTCATGGTCTCTGCAAGGAAGG - Intronic
1141914669 16:87087045-87087067 GTTGATGACAGGAGCAAAGAAGG + Intronic
1142510549 17:389966-389988 GGTGCTGGCAGGTGGAAGGAGGG - Intergenic
1142858609 17:2747829-2747851 ATTGATGCCATGTCCAAGAAAGG - Intergenic
1145728078 17:27152489-27152511 GTGGACAGCTTGTGCAAGGAAGG + Intergenic
1146706681 17:35005366-35005388 GCTGATGGCATGTGCAGCCAGGG - Exonic
1148773052 17:50077974-50077996 GGTGATGTCATGGGGAAGGAGGG - Intronic
1151374791 17:73680130-73680152 GTTTATGGCAGGTGGGAGGAAGG + Intergenic
1152905058 17:82965477-82965499 GATGCTGGCAGGTGCCAGGAGGG + Intronic
1153166625 18:2268968-2268990 GTTGATGGCTTTACCAAGGATGG - Intergenic
1156269970 18:35521597-35521619 CTTGATCCCATGTGCAAGGCTGG - Intergenic
1156528395 18:37790957-37790979 GGGGATAGCATGAGCAAGGATGG + Intergenic
1159950379 18:74478437-74478459 GTTTATGAGATGTGTAAGGAAGG - Intergenic
1163604979 19:18269266-18269288 GTAAATGGCATATGGAAGGATGG + Intronic
1166196998 19:41213533-41213555 ATTAATGGCATGTAAAAGGATGG - Intergenic
925156906 2:1655754-1655776 GTAGGTGGCATGTGTCAGGAGGG - Intronic
928457471 2:31435559-31435581 GTTGAGGGTATCTGCAAGGGAGG + Intergenic
929429682 2:41876725-41876747 GTGGATGACATTTGGAAGGATGG - Intergenic
932050088 2:68389477-68389499 ATTAATGGAATGGGCAAGGAGGG + Intronic
933192827 2:79355440-79355462 TTTTATGGAATGTTCAAGGAAGG - Intronic
935160529 2:100525986-100526008 GCTGTTCGCATGTGAAAGGAGGG - Intergenic
935351978 2:102158899-102158921 GTTGATGGCTTGTCAAAGGGTGG + Intronic
936647123 2:114384800-114384822 GTTGATGGCATTTGGAGGTAGGG - Intergenic
941196546 2:162459759-162459781 TTTGGTGGCCTTTGCAAGGAAGG + Intronic
942066749 2:172278885-172278907 GGTGATGACATCTGCAAGGATGG + Intergenic
946574841 2:221063746-221063768 ACTGATGGCAGGTGCAAGGCAGG + Intergenic
1169224598 20:3848073-3848095 GCTGATGCCATGAGAAAGGAAGG + Intronic
1172832858 20:37850999-37851021 GATGGAGGCATGTGCAAAGATGG + Intronic
1174202877 20:48819444-48819466 TTAGATGGGATGGGCAAGGAAGG - Intronic
1175565530 20:59973296-59973318 GATCATGGTCTGTGCAAGGATGG + Intronic
1177401909 21:20615340-20615362 GTTGATGGTATGTGGAACAATGG + Intergenic
1178689696 21:34740763-34740785 GTTGATGGAATCTGAAAGGCTGG - Intergenic
1179995401 21:44971710-44971732 GCTGATGGCTTCTGCAAGGATGG + Intronic
1182237979 22:28891547-28891569 GTAGATGGCATGTGCCAGAGAGG + Intronic
1183316134 22:37137808-37137830 GGTGGTAGCATGTGCCAGGAGGG - Intronic
1184055307 22:42043583-42043605 GTTGTAGGCATGTGCATGGAGGG + Intronic
949447092 3:4146443-4146465 GTTGATTTCATGTGGAAGGTTGG - Intronic
949825102 3:8156863-8156885 GTAGATGGTAAGTGCAATGAAGG - Intergenic
951803692 3:26623774-26623796 GGGGGTGGCGTGTGCAAGGATGG - Intronic
954640063 3:52092517-52092539 GTTGCTGCCATGTGCCAGGTGGG + Intronic
954691950 3:52400306-52400328 GTTCCTGGAATGGGCAAGGAGGG - Exonic
956089589 3:65651682-65651704 CTTGGTGTCATATGCAAGGATGG - Intronic
956543474 3:70371762-70371784 GTTCATGTCATCTGCAAAGAGGG + Intergenic
957459659 3:80500148-80500170 ATTCATGGCATGTGCAGGGTAGG + Intergenic
959783646 3:110267159-110267181 GTTGATGGAATCTGCATGGAGGG - Intergenic
960982961 3:123249215-123249237 GTGGGTGCCATGTGCCAGGAAGG - Intronic
961053195 3:123764909-123764931 GATGATGGCATGTGAATAGATGG - Intronic
963755495 3:149231338-149231360 GTGGATGGCAAGAGAAAGGAGGG + Intergenic
964006309 3:151833524-151833546 GTTGATGGCTTATGCAAGGGAGG - Intergenic
965600981 3:170454457-170454479 GTTGATGGAAAGGGCAGGGAAGG - Intronic
967443136 3:189532418-189532440 GCTGATGGAAAGTGCAAGTAGGG - Intergenic
967925501 3:194642464-194642486 GTAGATGGCATTTGAAAGTATGG - Intronic
968869581 4:3234895-3234917 CATGATGGCATGTGCCATGAAGG + Intronic
970214918 4:13748877-13748899 TTTCATGGCATCTGCAATGATGG + Intergenic
971501637 4:27324715-27324737 GATGATGTCATTTCCAAGGATGG + Intergenic
974222369 4:58992163-58992185 GTTTATGTCATCTGCAAAGAAGG - Intergenic
975975970 4:80097205-80097227 GGTGATGGCATTTGAAAGGTGGG - Intronic
981025629 4:140074323-140074345 GTTGCTGGTAGGTACAAGGAAGG - Intronic
983337781 4:166418746-166418768 GTTTATGTAGTGTGCAAGGAAGG - Intergenic
986079535 5:4375784-4375806 GTCGATGGGGTGGGCAAGGAAGG - Intergenic
987530946 5:19118681-19118703 GATCATGTCATGTGCAAAGAGGG - Intergenic
987949000 5:24652077-24652099 GTTGATTGCAAGGGCCAGGATGG - Intergenic
989272071 5:39545175-39545197 GTTGATATCATCTGCAAGGCAGG - Intergenic
991602953 5:68371762-68371784 CTAGAAGGCATATGCAAGGAGGG - Intergenic
993079169 5:83274366-83274388 GTACATGGCATGAGCAGGGAAGG - Intronic
995234202 5:109807562-109807584 GTGGATGGGATATACAAGGAAGG - Intronic
997207378 5:132057667-132057689 GATGATGCCATGTGGCAGGAGGG - Intergenic
997364745 5:133318778-133318800 GTTGGGGGGATCTGCAAGGATGG - Intronic
998052265 5:139045804-139045826 GTTGAAGGAAGGTGCAGGGAGGG - Intronic
998513124 5:142730151-142730173 GCTGATGTCATGTGCATGGTGGG - Intergenic
1004221104 6:13747126-13747148 GTTGGTGGAATGGGCCAGGAAGG + Intergenic
1004962638 6:20808457-20808479 GTTGATTGGATGTGCAAAGGGGG + Intronic
1005913906 6:30335409-30335431 GATGATGGCTTGAGCAAAGAAGG - Intronic
1005949694 6:30622633-30622655 GAATATGGGATGTGCAAGGATGG + Intronic
1010707110 6:79127953-79127975 GCTGCTGGCATGTGCAAACAAGG + Intergenic
1012025841 6:93989799-93989821 GATGATGTCATCTGCAAAGAAGG - Intergenic
1012414127 6:98994071-98994093 CTTGATGTCATGGGCAAGGAGGG - Intergenic
1012770343 6:103425202-103425224 GTTGATTGGATCTGCAGGGATGG - Intergenic
1014643892 6:123949727-123949749 GTTTATATCATCTGCAAGGAAGG + Intronic
1016752376 6:147645201-147645223 GTTGATGGCATGTGCAAGGAGGG + Intronic
1017033714 6:150248171-150248193 GTTGATGGCATTTGGAGGTAGGG - Intronic
1017947634 6:159108625-159108647 GATGATGTCATGTTCCAGGAGGG + Intergenic
1018625550 6:165775044-165775066 GCTGTTGGCCTGGGCAAGGAGGG + Intronic
1020348312 7:7188606-7188628 CTGGGTGGCATGAGCAAGGAAGG - Intronic
1027381718 7:77617596-77617618 GTTGATAGTATGTGTAACGATGG + Intronic
1028027998 7:85870647-85870669 GTTCATGTCATTTGCAAAGAGGG - Intergenic
1028734265 7:94189514-94189536 GCTCTTGGCATGTGCAAGCAAGG - Intergenic
1032199279 7:129808022-129808044 GGTGGTGGCCTGGGCAAGGATGG - Intergenic
1037166109 8:15830972-15830994 ACTGCTGGCATGTGCAAGCAAGG + Intergenic
1040093026 8:43418306-43418328 GTTTATGTCATCTGCAAAGAGGG + Intergenic
1042392822 8:68255771-68255793 ATTGATGGCAATTGCAAGAAGGG + Intergenic
1044181556 8:89201971-89201993 TTTGATGCCATGCACAAGGAGGG - Intergenic
1046990696 8:120449589-120449611 GGTGAAGGCATGAGAAAGGATGG + Intronic
1048589350 8:135806613-135806635 TTAGATGGCATGTGCCAGGATGG + Intergenic
1050200667 9:3142250-3142272 GTTCATGTCCTTTGCAAGGATGG - Intergenic
1053086140 9:35224560-35224582 GATCATGTCATGTGCAAAGAGGG + Intronic
1053276345 9:36786483-36786505 GTAGATGGGATGGCCAAGGAAGG + Intergenic
1054754417 9:68942959-68942981 TTTGGTGGCATGTTCCAGGATGG - Intronic
1055433257 9:76266548-76266570 GATTCTGGCATGTGCATGGAGGG - Intronic
1056996027 9:91460241-91460263 ATTGCTGCCATGGGCAAGGAGGG + Intergenic
1057943779 9:99306765-99306787 GCTGGAGGCATGGGCAAGGAGGG - Intergenic
1058315071 9:103554704-103554726 GCTGCTGGCATGTGCAAACAAGG + Intergenic
1058370951 9:104266985-104267007 GTTGGTGGTAAGTGCTAGGAAGG + Intergenic
1058927180 9:109678019-109678041 GTTAGTGGCCTGAGCAAGGAGGG + Intronic
1059466521 9:114472165-114472187 GTAGATGGCAGGAGCAAGGGTGG - Intronic
1059753054 9:117267060-117267082 GTTGATACCATGTACCAGGATGG + Intronic
1186579998 X:10807606-10807628 GAAGAGGTCATGTGCAAGGATGG - Intronic
1189088385 X:38051055-38051077 GGTGATGGAATGTGGAGGGAAGG + Intronic
1189117006 X:38353279-38353301 CTTGCTGGCATGTGCAAAGCAGG + Intronic
1189701028 X:43716392-43716414 GTGGATGGGATCTGCCAGGATGG + Intronic
1190791109 X:53701165-53701187 GTAGGGGCCATGTGCAAGGATGG + Intergenic
1191075141 X:56445019-56445041 GCTGCTGGCATGTGCAAAGAAGG - Intergenic
1192872069 X:75194428-75194450 GTTGTTGGCATGTGCAAATGAGG - Intergenic
1193823607 X:86195611-86195633 GCTGCTGGCATGTGCAAATAAGG + Intronic
1194195920 X:90892735-90892757 GTGGATGGAATATGCATGGAGGG - Intergenic
1194915977 X:99709146-99709168 GTTGATGGCTTGAAGAAGGAAGG - Intergenic
1195507314 X:105672748-105672770 TTTGCTGGCATGGGCAGGGATGG + Intronic
1196498357 X:116348936-116348958 TTACATGGCATGTCCAAGGAAGG - Intergenic
1198224476 X:134632607-134632629 GTTGATGGGATGGGACAGGACGG - Intronic
1199927387 X:152481180-152481202 GTTGGAGGCATGGGCAAGGGTGG - Intergenic
1200541768 Y:4466928-4466950 GTGGATGGAATATGCATGGAGGG - Intergenic
1200936984 Y:8746875-8746897 GTTGATGGCTTGTGTAATTAAGG + Intergenic
1200964008 Y:9019964-9019986 GTGGATGGCTTGTGCAATTAAGG + Intergenic
1201395189 Y:13539935-13539957 GCTGCTGGCATGTGCAAACAAGG + Intergenic