ID: 1016753534

View in Genome Browser
Species Human (GRCh38)
Location 6:147658674-147658696
Sequence CTTTCAAGTCAGAACGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016753530_1016753534 0 Left 1016753530 6:147658651-147658673 CCTACTGGGTTTTTTTTTTTCCA 0: 1
1: 1
2: 8
3: 164
4: 1356
Right 1016753534 6:147658674-147658696 CTTTCAAGTCAGAACGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016753534 Original CRISPR CTTTCAAGTCAGAACGTGGG TGG Intronic
903565086 1:24259151-24259173 CTTTTAAGTCTGCACGTGGCGGG + Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
905910588 1:41650823-41650845 CCTTCAGGTCTTAACGTGGGAGG - Intronic
907874969 1:58476894-58476916 CTTTGGAGTCAGAAGATGGGAGG + Intronic
913074751 1:115332560-115332582 CTTCCAAGGGAGAACGTGAGGGG + Intronic
913681603 1:121191082-121191104 CTTTCAAGTCAGACATTGAGAGG - Intronic
914033438 1:143978719-143978741 CTTTCAAGTCAGACATTGAGAGG - Intergenic
914156007 1:145089252-145089274 CTTTCAAGTCAGACATTGAGAGG + Intronic
915153794 1:153857606-153857628 TTATCAAGTTAGAAAGTGGGAGG + Intronic
920468919 1:206209600-206209622 CTTTCAAGTCAGACATTGAGAGG - Intronic
921772474 1:219058305-219058327 TTTTGAAGTCAGAAAGTGTGAGG - Intergenic
923149119 1:231218067-231218089 CTTTGAAGTCAGAACATTGAAGG - Intronic
1062852891 10:759328-759350 CTGTCAGGTCAGGACCTGGGTGG - Intergenic
1064242192 10:13640799-13640821 CTATCATGTCAGAGCATGGGAGG - Intronic
1070921133 10:80187118-80187140 CTTTGGAGTCAGGACTTGGGTGG - Intronic
1074300538 10:112229162-112229184 CTGTCAAATTAGAACTTGGGAGG - Intergenic
1077847330 11:6039679-6039701 GTCTCAATTCAGAACCTGGGGGG + Intergenic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1087385098 11:97461242-97461264 CTTCCAACTCAGAAGGTGGTGGG - Intergenic
1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG + Exonic
1091336906 11:134777733-134777755 TTTTCAAGTCAGGAAGTGTGAGG - Intergenic
1092034995 12:5326467-5326489 CCTTCCATTCAGAACGTGAGAGG - Intergenic
1092585075 12:9891561-9891583 CTCTCAAATCATAACTTGGGAGG + Intronic
1099713335 12:86257728-86257750 CATAAAAGTCAGAACTTGGGAGG - Intronic
1107181326 13:37463308-37463330 CTTTCAAGTCAGGAAATGTGAGG + Intergenic
1121697117 14:95922671-95922693 CTTGCAGGTCAGAACATGGTGGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1128965132 15:72051337-72051359 CTGTCAACTCAGAAGGTGGCAGG - Intronic
1137527955 16:49253432-49253454 CATTCAAGTCAGATCATGAGAGG - Intergenic
1139652447 16:68369316-68369338 CTTTCAGGACAGAACCTGGGAGG + Intronic
1152212262 17:79009028-79009050 ATTTGAAGTCAGAAGGTGGTGGG + Intronic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1155017902 18:21863619-21863641 CTTTAAAGGCACAACATGGGAGG + Intronic
1156587489 18:38447466-38447488 CTTTCAAGTGAGGACTTGAGGGG - Intergenic
1161936247 19:7374015-7374037 CTGTCATGTCAGCACTTGGGAGG - Intronic
1164395657 19:27860979-27861001 CTCTCAACTCAGAATGTGTGAGG - Intergenic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
929175610 2:38972331-38972353 CTTTCAAGGGAGAACTCGGGGGG + Intronic
930436915 2:51356051-51356073 CTCTCAAGTCAGAATGCGTGAGG - Intergenic
933515257 2:83292258-83292280 CTTGCAAGTCTGAACATGGAGGG + Intergenic
933581321 2:84129982-84130004 ACTCCAAGTCAGAATGTGGGTGG - Intergenic
935094918 2:99935080-99935102 CATTCATGTCTGAACATGGGAGG + Intronic
939417357 2:141916680-141916702 CTTACAAGTGAGAAGGTGTGGGG - Intronic
945493584 2:210483482-210483504 CTCTCAAGTCAGAAGGTCTGGGG - Intronic
1169465731 20:5836685-5836707 CTGGCCAGTCAGGACGTGGGAGG + Intronic
1170522360 20:17199843-17199865 ATTTCAAGTCAGAACATGTAAGG - Intergenic
1170914396 20:20608747-20608769 ATCTCACGTAAGAACGTGGGAGG + Intronic
1171748166 20:29020589-29020611 ATTTCAAGTAAGAGGGTGGGAGG + Intergenic
1178189957 21:30268879-30268901 TCTTCAAATCAGAAGGTGGGAGG - Intergenic
1178888289 21:36499369-36499391 GTTTCAAGTAAAAACTTGGGAGG - Intronic
1181559423 22:23691636-23691658 CATTCTAGTCAGAATCTGGGAGG - Exonic
1181712713 22:24700697-24700719 CATTCTAGTCAGAATCTGGGAGG - Intergenic
1181986626 22:26804332-26804354 CTTTCAAGTGAGAGCCTTGGGGG + Intergenic
1184377952 22:44126478-44126500 CTTTCAACTCAGAAGGCTGGAGG + Intronic
952175584 3:30859107-30859129 CTTTGAAGTGAGAATGTAGGAGG + Intronic
954776557 3:53024220-53024242 CTTCCAAGTCTGGAGGTGGGTGG + Intronic
961747361 3:129073089-129073111 ATTCCAAGACAGAAAGTGGGTGG + Intergenic
962624361 3:137210635-137210657 CTTTCAAGACAGAATCTAGGAGG + Intergenic
963669499 3:148233791-148233813 CTTTTTAGTCAGAAAGAGGGAGG + Intergenic
982546235 4:156736563-156736585 CTTTCAACTCAGAACTGGGAAGG + Intergenic
983555987 4:169059626-169059648 CTTTCAAGACAGAACCTAAGCGG + Intergenic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
988224669 5:28397876-28397898 TTTTAAAGGGAGAACGTGGGAGG + Intergenic
991081664 5:62607714-62607736 CTCTCAACTCATAACCTGGGTGG - Intronic
993495316 5:88602384-88602406 TTTTTAAGTGAGAATGTGGGAGG - Intergenic
995035043 5:107524161-107524183 ATTTCAAGTTAGAATGTGCGTGG - Intronic
999205075 5:149841914-149841936 CTTTCAAGTCTGAGCAGGGGAGG - Intronic
1004991031 6:21138980-21139002 CTTTCAAGAGAGAATGTGAGAGG + Intronic
1006738620 6:36292351-36292373 CAGTGAAGTCAGAACGGGGGTGG - Intronic
1010424339 6:75709925-75709947 CTTTCAAGTCAGAAGTTGCCAGG + Intronic
1011661683 6:89600120-89600142 CTTTCAGTTCAGACCTTGGGAGG - Intronic
1012621354 6:101348326-101348348 CTTTCAATTCACAGCTTGGGTGG - Intergenic
1014700038 6:124674277-124674299 TTTTGAAGTCAGGACGTGTGAGG + Intronic
1016753534 6:147658674-147658696 CTTTCAAGTCAGAACGTGGGTGG + Intronic
1029027727 7:97435236-97435258 CTTTCATGACAGAACGTGGAGGG - Intergenic
1030646551 7:112067698-112067720 CTTTCCAGTCAGTACCTGTGGGG + Intronic
1032919371 7:136527970-136527992 CTTTCAACTCAGAAGGGGGCTGG + Intergenic
1041602892 8:59742572-59742594 ATTTGAAGTCAGAACACGGGAGG + Intergenic
1042463671 8:69101521-69101543 TTTTCAAGAGAGAACCTGGGAGG - Intergenic
1045206125 8:100042973-100042995 CTTTCAAGTCAGAATGGAGGAGG - Intronic
1047715963 8:127595645-127595667 CTTTCAAGTCAGGAAGTCAGGGG - Intergenic
1048067915 8:130990294-130990316 CTTTTAAGTCAGGACGTGTTTGG + Intronic
1048714207 8:137249572-137249594 ATTTGAAGTCAGAAAATGGGAGG - Intergenic
1051317585 9:15858333-15858355 TTTTGAAGTCAGAAAGTGTGAGG + Intronic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1056004327 9:82251096-82251118 TTGTCAAGTGAGAAGGTGGGTGG - Intergenic
1062713223 9:137988042-137988064 CTTTCAAGTCAGAGAAAGGGAGG - Intronic
1185701607 X:2235195-2235217 CTTGCAAGTGAGAACATGGCAGG - Intronic
1186073427 X:5849184-5849206 CCTTCAAGACAGAACATGAGTGG - Intronic
1187514485 X:19955142-19955164 CTTTCAAGTTAGAAAGGGAGAGG - Intronic
1189145265 X:38649269-38649291 CTCACAAGTCAGAAGGGGGGTGG + Intronic
1191039001 X:56058580-56058602 CTTACAAGTAAGAACATGTGGGG + Intergenic
1193881110 X:86922107-86922129 ATTTCAAGTCATAACTTGGAAGG - Intergenic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1199027160 X:142953481-142953503 CTTATAAGTGAGAATGTGGGTGG + Intergenic
1202032881 Y:20596388-20596410 CTTTGAAGTCAGACAGTGTGAGG - Intergenic