ID: 1016756968

View in Genome Browser
Species Human (GRCh38)
Location 6:147697877-147697899
Sequence TTTAGCTAAAAAAACTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016756967_1016756968 -2 Left 1016756967 6:147697856-147697878 CCAGAAGGGTCAGTTTCTATGTT 0: 3
1: 46
2: 95
3: 114
4: 196
Right 1016756968 6:147697877-147697899 TTTAGCTAAAAAAACTATGTAGG 0: 1
1: 0
2: 0
3: 28
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016756968 Original CRISPR TTTAGCTAAAAAAACTATGT AGG Intronic
900251544 1:1672879-1672901 TTTAGCAAAAAGAAGTCTGTGGG - Intronic
900261905 1:1735414-1735436 TTTAGCAAAAAGAAGTCTGTGGG - Intronic
900271556 1:1792395-1792417 TGTAGTTAAAATATCTATGTTGG + Intronic
902832239 1:19023253-19023275 TACATCTAAAAAAAGTATGTTGG + Intergenic
903267925 1:22169382-22169404 TTCAGCTAAAGGAAATATGTTGG - Intergenic
905552653 1:38856163-38856185 ATTACTTAAAAAAATTATGTTGG - Intronic
907170847 1:52462928-52462950 TGTAGCTAAAAAGAACATGTTGG - Intronic
908243301 1:62206428-62206450 CTTAGTTAAGAAAACTATGCTGG - Intronic
908286537 1:62610147-62610169 TTTAACTATAAAAACTGAGTCGG - Intronic
908343811 1:63210826-63210848 TGTAGCTAAAAAAACAAAATTGG + Intergenic
909058387 1:70849680-70849702 TTTAGAGAAAAAATATATGTTGG + Intergenic
910248540 1:85168630-85168652 TTTAGATACAACAACTGTGTTGG - Intronic
911215918 1:95193908-95193930 TTTATATAATAAAACTATTTTGG + Exonic
912168740 1:107071526-107071548 TTGAGATAAAAAAGCTTTGTGGG - Intergenic
912746088 1:112246743-112246765 TGTAGATAAAAATACTATTTAGG + Intergenic
914461622 1:147890761-147890783 TTTATTTAAAAAAAATATTTTGG - Intergenic
914720424 1:150284318-150284340 TTGATCTAAAAAAATTAAGTCGG - Intronic
916911388 1:169350900-169350922 TATAGCTAAAGAAACTAGTTGGG - Intronic
919238394 1:194876781-194876803 TTTTGCTAAAACAACTAGCTCGG + Intergenic
919863356 1:201758425-201758447 TTTAGCAAAAAGAATAATGTAGG - Intronic
920026336 1:203000449-203000471 TTTATTTACAAAAAATATGTAGG + Intergenic
920328416 1:205185507-205185529 TGTAGCTTAAAAAACACTGTTGG - Intronic
921233014 1:213092712-213092734 TTTAGCTTAAAAACATATCTTGG - Intronic
923333715 1:232949252-232949274 ATTATCTAAAAAAACAAAGTTGG - Intergenic
923843021 1:237695129-237695151 TTTATTTAAAAAAACAATTTGGG + Intronic
924720474 1:246618253-246618275 TTTAGGTAAGGAAACTATATAGG + Intronic
1064877239 10:20008252-20008274 TTAATCTAAAAAAAGAATGTAGG + Intronic
1066035339 10:31475895-31475917 CCTAGCTAACAAAACTATGATGG + Intronic
1067490482 10:46695696-46695718 TTTAGTTAATAAAACTAAATAGG + Intergenic
1067604180 10:47644672-47644694 TTTAGTTAATAAAACTAAATAGG - Intergenic
1067887515 10:50103257-50103279 TTTACTTAAAAGAAATATGTCGG + Intronic
1068192781 10:53673907-53673929 TTCAGCTACAAAAACTAAGGTGG - Intergenic
1068516983 10:58036980-58037002 TTTAGCAAACAAACCTATATTGG - Intergenic
1068563007 10:58538087-58538109 ATTATCTGAAAAAACGATGTTGG - Intronic
1072870102 10:99109662-99109684 TTTGGCTACAAAATCAATGTGGG + Intronic
1073740726 10:106403315-106403337 ATTAGCTCAATAAACTATGAGGG + Intergenic
1073934787 10:108618471-108618493 TTTAGTTAAAAAAAGTCAGTTGG + Intergenic
1074389062 10:113041869-113041891 TGTAGCTAAAAAATAAATGTGGG - Intronic
1075222030 10:120593370-120593392 TTTAGCTAGAAAAGCTCTTTAGG - Intergenic
1075234202 10:120711816-120711838 TTTTCCTAAAAAGACTGTGTGGG - Intergenic
1076417007 10:130298887-130298909 TATATCTAAGAAAATTATGTGGG + Intergenic
1079710288 11:23674862-23674884 TGTAGCTTATAAAATTATGTAGG + Intergenic
1080716774 11:34810142-34810164 TTGAGCTAGAAAAAATATGGTGG + Intergenic
1085111050 11:73888579-73888601 TTTAGTTATAAAAAATATTTTGG + Intronic
1085612066 11:77959596-77959618 TTTCTATAAGAAAACTATGTGGG - Intronic
1086263609 11:84971448-84971470 TTAAGATAAAAAAACTATTCTGG + Intronic
1086802145 11:91189750-91189772 ATTTTCTAAAAAAACTAAGTAGG + Intergenic
1087092908 11:94293370-94293392 TTTTGCTAAAAATCTTATGTGGG - Intergenic
1088335323 11:108697500-108697522 TTTAGCTAAAAAAGTGATTTGGG + Intronic
1088436676 11:109821025-109821047 TTTAGCTAAAAAAGGAATTTTGG - Intergenic
1088747781 11:112818816-112818838 TTTATATAAAAACATTATGTAGG + Intergenic
1091234360 11:134010465-134010487 TTTAGGTAGTAAAACTATGTTGG + Intergenic
1092838463 12:12515205-12515227 TTTGGCTAAAAAAATTAACTGGG - Intronic
1093845056 12:23960705-23960727 TTAAGCGAAAAAAACAAGGTAGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094334197 12:29329262-29329284 TTTAGCTTTAAACTCTATGTAGG + Intronic
1096169942 12:49459750-49459772 TATAGCTATAAAAAATATGGGGG - Intronic
1096953081 12:55495860-55495882 GTTACCAAAAAAACCTATGTTGG - Intergenic
1097133962 12:56836088-56836110 GTTAGCTAAAAAAAAAATATGGG - Intergenic
1097309969 12:58108392-58108414 TTTGGCTAAAAAAAATCTATAGG - Intergenic
1097806820 12:63974266-63974288 TTTATCTAAAAATGTTATGTAGG + Intronic
1099325759 12:81212955-81212977 CTTATCTAAAGAAACTATGCTGG + Intronic
1099360765 12:81697507-81697529 TTCAGCTAAAAAATCTATACAGG + Intronic
1099510309 12:83527457-83527479 TTTAGCAAAAAAAAATATTGAGG + Intergenic
1099572161 12:84336450-84336472 GTTATCTAAAAAAAGCATGTGGG - Intergenic
1099614630 12:84918960-84918982 TTTAGATTAAAAAAAAATGTGGG + Intergenic
1100337521 12:93645610-93645632 TTAAGCTGAAAAATCTTTGTTGG + Intergenic
1101287241 12:103327323-103327345 TTTAACAAATAAAACTATATAGG + Intronic
1101931601 12:109018771-109018793 TTTATATAAACAAAATATGTAGG - Intronic
1102424400 12:112829570-112829592 TTTTGCTAAAAAGCCTTTGTAGG - Intronic
1102762133 12:115397092-115397114 CTTAGATGAAACAACTATGTTGG - Intergenic
1104315215 12:127692520-127692542 TTTAGCTAAAAAATAAATTTTGG - Intergenic
1105567953 13:21570258-21570280 ATGACCTAAAAAAACTATGTTGG - Intronic
1107565544 13:41600135-41600157 TTTTGCTAAATATACTTTGTTGG - Intronic
1107831282 13:44375197-44375219 TTTAGCCAAAGAAACTATATTGG + Intronic
1108277363 13:48824972-48824994 TTTAGCAAACAAAACGATCTTGG + Intergenic
1109436152 13:62305841-62305863 TTCAGCTAAAAAAAAGATGAAGG - Intergenic
1109564507 13:64094668-64094690 TTTAGCTAAAATATCAAAGTGGG + Intergenic
1110183322 13:72643160-72643182 TCTTGCTAACAAAATTATGTAGG - Intergenic
1112349396 13:98620365-98620387 TTTATTTAAAAAAACTAAATGGG + Intergenic
1114721911 14:24891685-24891707 TTTATCTAGAAAAACTATTTAGG + Intronic
1114911943 14:27211144-27211166 TTTAGACAAAATAACTGTGTGGG - Intergenic
1116022241 14:39475154-39475176 TTTTGGTAATAAAATTATGTTGG + Intergenic
1116471619 14:45292253-45292275 GTTAACTAAAGAAACCATGTTGG - Intergenic
1116683135 14:48002409-48002431 TTTTGCTATAAAAATAATGTAGG + Intergenic
1116964101 14:50997011-50997033 GTTAGCTAAAAGAACTATGGTGG - Intronic
1118335792 14:64852606-64852628 ATCAGCTTACAAAACTATGTAGG + Intronic
1118713082 14:68538600-68538622 GCTAGCCAAACAAACTATGTTGG - Intronic
1119752156 14:77087094-77087116 TTAGGCTAAAAACACAATGTTGG + Intergenic
1120498987 14:85270344-85270366 TTCAGCAGAAATAACTATGTTGG - Intergenic
1125042274 15:35203655-35203677 TTTAGCTATTAAAATTATGATGG + Intergenic
1125070107 15:35544709-35544731 GTTTGCTAAAAAAGCAATGTTGG - Intronic
1125214755 15:37258721-37258743 TTTAATTAAAAAAATTTTGTGGG - Intergenic
1125798055 15:42418851-42418873 TATAGCTTAAAAAAATAAGTAGG - Intronic
1127636023 15:60870535-60870557 TTTAGCTAGCAAATCTCTGTGGG + Intronic
1127737833 15:61861537-61861559 TTTAGCAATAAAAATTATTTTGG + Intronic
1128058074 15:64715503-64715525 TTTAGTTAAAAAAACTGGCTGGG - Intergenic
1130030546 15:80309702-80309724 TTCAGAAAAAAAAACTATGTTGG + Intergenic
1130034963 15:80350855-80350877 TTTTTTTAAAAAAACTATGATGG + Intronic
1130179992 15:81616429-81616451 TTTAGCTAACATAGCTATATGGG + Intergenic
1131839846 15:96425396-96425418 TTATGCTAGTAAAACTATGTTGG - Intergenic
1132275684 15:100561543-100561565 TTTATCTTAAAAAAATATATAGG + Intronic
1133089463 16:3392511-3392533 TTAAACTAAAAAAATTATCTTGG - Intronic
1133896811 16:9937495-9937517 TTTATTTAAAAAAATTTTGTGGG - Intronic
1136178004 16:28531820-28531842 TTTAGTTAAAAAATCAATTTTGG + Intergenic
1138616967 16:58176353-58176375 TGTAGCTAGAAATACTGTGTTGG - Intronic
1138786113 16:59848642-59848664 AATAGCTAAAAAAGCTATCTTGG - Intergenic
1139056553 16:63192692-63192714 TTTAGCAAAAAAAAGTATTGTGG - Intergenic
1141959431 16:87394569-87394591 TGTAGCTAAAGAAACTGGGTGGG + Intronic
1144314306 17:14045557-14045579 TTTATCTATAAAAACTTTGTAGG - Intergenic
1146248192 17:31310157-31310179 TTTACCTACAGAAACAATGTTGG - Intronic
1146560635 17:33866431-33866453 TTTTTCAAAAAAAAATATGTGGG - Intronic
1150025621 17:61671237-61671259 TTTACCTACAAAAAGAATGTTGG - Intergenic
1151057568 17:71051047-71051069 TTCAGCCAAAAAAAATGTGTTGG - Intergenic
1151102915 17:71575953-71575975 TTTATTTAAAAAAATTATTTTGG + Intergenic
1153546804 18:6215590-6215612 TTTAGTTAAAAATACAAAGTAGG - Intronic
1153687438 18:7560432-7560454 TTTAGGTAAAATGACTAGGTAGG - Intergenic
1155697805 18:28703988-28704010 TTTATTTAAAAAATCTATCTTGG + Intergenic
1157452749 18:47800678-47800700 TTTAGTAAAAAGAACTATGTGGG - Intergenic
1157745510 18:50131657-50131679 TGTAGCTCAAAAACCTATGGGGG + Intronic
1159412246 18:68094252-68094274 TTTATTTAAAAAAAGTATTTGGG + Intergenic
1160212481 18:76893953-76893975 TTTCCCTAAGAAAACTATGTTGG + Intronic
1160394344 18:78560678-78560700 ATTAGCTTAAAAAAGAATGTAGG - Intergenic
1165947633 19:39454044-39454066 TTTAGGTAATAAGACTTTGTAGG + Intronic
925219962 2:2131014-2131036 TTCAGCTTTAAAAACTATTTAGG - Intronic
925534172 2:4899171-4899193 TTTAACTAAAAAAATTAATTAGG + Intergenic
926039062 2:9658284-9658306 TCTAGCAAAAAAAAAAATGTTGG - Intergenic
927633594 2:24795013-24795035 TTTAGATAATAAAAGTATATGGG + Intronic
927935544 2:27074009-27074031 CTTGGATAAAAAAACTACGTGGG + Intergenic
929994290 2:46815719-46815741 TTTAGCTCAAAAAAGTTTGTTGG - Intergenic
930269395 2:49238641-49238663 TTCAGGTAAAAAATCTATGAAGG + Intergenic
930793164 2:55356440-55356462 TTTTGTTAAAAAAACTAGGAAGG - Intronic
930917809 2:56715225-56715247 TATAGTTATAAAAAGTATGTTGG - Intergenic
930945642 2:57071371-57071393 TTTAGTAATAAAAAGTATGTGGG - Intergenic
932278239 2:70467645-70467667 TTTCCCCAAAAAAACTAAGTGGG - Intronic
933932140 2:87163764-87163786 TTAAGTTAAAAAACCTAAGTTGG - Intergenic
934803413 2:97192012-97192034 TTTAGAAATAAAAATTATGTTGG + Intronic
935200132 2:100849285-100849307 TTTAGCTAAAGACCCTATTTAGG - Intronic
935534258 2:104274520-104274542 TGAAGCTAGAAAAACTATGTTGG + Intergenic
935834246 2:107033274-107033296 TTAAGGAAACAAAACTATGTAGG - Intergenic
937173037 2:119896198-119896220 TTTAAAAAAAAATACTATGTAGG - Intronic
939710591 2:145513654-145513676 ATTAACTCAACAAACTATGTAGG + Intergenic
939922403 2:148133001-148133023 TTTAGGTAAAAAATCTTTTTAGG - Intronic
940346060 2:152630330-152630352 CTCAGCTAAGTAAACTATGTGGG + Intronic
941104054 2:161332382-161332404 TTTATTTAAAAAAATTATTTTGG + Intronic
942444892 2:176071343-176071365 TTTGGCTAGCAAAGCTATGTCGG + Intergenic
943436968 2:187876969-187876991 ATTAGCTTAATAAATTATGTAGG + Intergenic
944836240 2:203582779-203582801 TTGACCTAAAGAAAGTATGTTGG + Intergenic
945129357 2:206552018-206552040 TTCAGATAAAAAAACTATCTTGG - Intronic
945653512 2:212594656-212594678 TTTACTTAAAAATACTATTTAGG - Intergenic
946668064 2:222072168-222072190 TTTAGCTAAAAAACACATGCTGG + Intergenic
1169983432 20:11413209-11413231 ATTAGCTTAAAAAATTATTTAGG - Intergenic
1170304998 20:14928845-14928867 TTTAGCCATAAAAATAATGTTGG - Intronic
1170365145 20:15589866-15589888 TTTAGGTCAAAAATTTATGTGGG - Intronic
1171060020 20:21947394-21947416 ATGAGCTTAAAAAATTATGTGGG + Intergenic
1171446950 20:25211628-25211650 TTCAGCCAAAAAAACTAAGGAGG - Intronic
1172946187 20:38691347-38691369 TTTAGCTTAAAACACTTTTTTGG - Intergenic
1173205153 20:40987070-40987092 TTTAGCTAAAATAATTGTTTTGG + Intergenic
1175203931 20:57296864-57296886 TTTATCTATAAAAAATATCTGGG + Intergenic
1175707226 20:61188896-61188918 TTTAGCTAAAATATCTGTGCTGG - Intergenic
1176950391 21:15038513-15038535 TTTGGATAATAAAATTATGTTGG - Intronic
1177506456 21:22025320-22025342 TTTACCTAAATCAACTATTTTGG - Intergenic
1177719896 21:24892203-24892225 ATTAGCTTAAATTACTATGTTGG - Intergenic
1178230237 21:30775296-30775318 TTTAGATAAAAAAACACTTTGGG - Intergenic
1179232801 21:39520107-39520129 CTCAGCTAAAAATACCATGTGGG - Intergenic
1180389175 22:12209235-12209257 ATTTGCTAAAAAAATTATATAGG - Intergenic
1180416765 22:12725237-12725259 ATTTGCTAAAAAAATTATATAGG + Intergenic
949706333 3:6822016-6822038 ATTATCTAAATAATCTATGTTGG + Intronic
949789798 3:7780696-7780718 TTTAGTTAAAAAAACTTCCTAGG - Intergenic
950690882 3:14656464-14656486 TTTTGGTAAGAATACTATGTGGG + Intronic
951386336 3:22047910-22047932 ATTAGCAAAAAAACCAATGTAGG - Intronic
951416635 3:22431931-22431953 TTTAGCTAAAGGAAGTATGATGG - Intergenic
952025067 3:29070304-29070326 TTAAGCTAAAAAAACAAAGCTGG - Intergenic
953955663 3:47230115-47230137 TTTATTTAAAATAACTATCTGGG + Intronic
954023043 3:47759324-47759346 TTTAGCAAAAAAAATTAGGCTGG + Intronic
954640084 3:52092651-52092673 TTCATCTAAAACAACTACGTGGG + Intronic
955116943 3:56015083-56015105 TTTTGCTAAAAAAACCATGGAGG - Intronic
956483283 3:69694432-69694454 TTTAACTAAATAAACTGTGATGG - Intergenic
957100183 3:75817168-75817190 ATTCGCTAACAAAAATATGTAGG - Intergenic
957274892 3:78078215-78078237 TCTTGCTAAAGAAACTATTTAGG + Intergenic
957693999 3:83610039-83610061 TGCAGCTTCAAAAACTATGTTGG + Intergenic
958118477 3:89254235-89254257 TTTAGTTAAAAAATTTATGTTGG + Intronic
958159357 3:89797062-89797084 TTTAGAAGAAAAAAATATGTAGG - Intergenic
959643284 3:108665847-108665869 TTTAGCAAAAAATATTCTGTAGG + Intronic
960223573 3:115145928-115145950 TTCAGCTAAAAAAATTATAGAGG - Intronic
960469174 3:118039836-118039858 TTTATCTAGAAATTCTATGTGGG + Intergenic
960944837 3:122958743-122958765 TTTAGCTCTAAAATCTATGGGGG + Intronic
961607877 3:128110871-128110893 TTTAGCTAAAAAATATGTCTGGG - Intronic
963118296 3:141752870-141752892 TGTACCCAAGAAAACTATGTAGG + Intergenic
963327487 3:143878051-143878073 TGTAGCTTAAAATAGTATGTTGG - Intergenic
963660198 3:148115624-148115646 TTTACTTCAAAAAAATATGTGGG + Intergenic
965405503 3:168263425-168263447 TCTAGCTAAAGAAATAATGTGGG - Intergenic
965767895 3:172150725-172150747 TTTATTTAAAAAAAGTTTGTGGG + Intronic
966132840 3:176663698-176663720 TTTACCCAAAAAAAGTCTGTAGG + Intergenic
966675607 3:182584367-182584389 TTTATATAAAATAACTATATAGG - Intergenic
966880751 3:184349188-184349210 TTTAGTTAAAAAAATTTTCTGGG + Intronic
967899119 3:194429238-194429260 TTTTGCCAAAAAAACCATGTTGG - Intronic
971099340 4:23445861-23445883 TTGAGCTAAGCAAACTATGCTGG - Intergenic
971686455 4:29775604-29775626 TTTAGCCAAGAAAACTGTGTAGG - Intergenic
971778366 4:30997646-30997668 TTTAGGAAAAAAAATTGTGTAGG - Intronic
972118575 4:35670746-35670768 TTTAGCAAAGAAAATTATTTGGG - Intergenic
974308274 4:60171270-60171292 TTTGGATAAAAGAACTATTTGGG + Intergenic
975139772 4:70907172-70907194 TTTAGCAAAAAGAAGTAAGTAGG - Intronic
975768614 4:77696618-77696640 TTTAGTTAAAAAAAGAATATGGG - Intergenic
976966277 4:91045123-91045145 TTTTGGTAAAATACCTATGTGGG + Intronic
977544561 4:98362175-98362197 TTTATCTTGAAAAACAATGTAGG + Intronic
977801690 4:101241902-101241924 TTTACCTGAAAATACTATTTTGG - Intronic
980381457 4:132024927-132024949 TTTTGTTAAAAAAAATATGTAGG - Intergenic
980618551 4:135266976-135266998 TATAGCTAAAAAAATTGTATGGG + Intergenic
980636397 4:135510160-135510182 TTTAGCTAAAATAGTTATGTTGG - Intergenic
981426349 4:144607940-144607962 TTAAGACAAAAAAACTATGTGGG + Intergenic
981644513 4:146983847-146983869 TTTAGTGAAAAAAACTGTCTGGG + Intergenic
981792566 4:148555321-148555343 TTCAGCTACAAAACATATGTGGG - Intergenic
981978050 4:150755655-150755677 ATTAGCCAATAAAACTATGCCGG + Intronic
982617336 4:157655766-157655788 TTTTGCTATAAAAATTTTGTTGG - Intergenic
982974689 4:162040480-162040502 TTTATCAAAAACAACTATTTTGG + Intronic
982983989 4:162181087-162181109 TTTAGTACAAAAAACTATATTGG + Intergenic
983305891 4:165986107-165986129 TTTACCTCAAAAAACAAAGTTGG - Intronic
983821864 4:172204044-172204066 CTTAGTTAAAAAAATTCTGTTGG - Intronic
983836440 4:172392287-172392309 TTTAATTAAAATAACTATTTAGG - Intronic
984427494 4:179606513-179606535 TTTATCTGAAAAAAGTAAGTAGG + Intergenic
985021438 4:185695253-185695275 TTTGGCTAAGAATTCTATGTAGG + Intronic
987139077 5:14927263-14927285 TTTAGGTAACAAAAATATTTTGG - Intergenic
987922051 5:24295835-24295857 TTTAGCTAAAAAAGTTTTGGGGG - Intergenic
988140706 5:27235633-27235655 TTTAGCAAAAAACAATATTTAGG - Intergenic
989358163 5:40567922-40567944 TTTACCTAAAATTAATATGTAGG + Intergenic
990279965 5:54239731-54239753 TTTAGCTCAAATAACCATTTTGG + Intronic
991229317 5:64312545-64312567 TTTAGCATCAAAAACTGTGTTGG + Intronic
991381418 5:66031831-66031853 TTTATTTAAAAAAACTATCTTGG - Intronic
992475198 5:77095160-77095182 TTTAGCAAAAAAAAACATCTGGG - Intergenic
992660700 5:78957999-78958021 TTTATATAAAAAAACTTTTTTGG + Intronic
992722224 5:79571646-79571668 TTTATTTAAAAAAATTATTTTGG - Intergenic
993309926 5:86316259-86316281 TTTATCTAAAGAAACCATGAAGG + Intergenic
993322226 5:86486012-86486034 TTCAGATAAAATAATTATGTGGG - Intergenic
993343971 5:86759469-86759491 TTTAGCTACAAACATTATATTGG + Intergenic
994728820 5:103468045-103468067 GATAGCTATTAAAACTATGTAGG + Intergenic
994769179 5:103959572-103959594 TTTAGAAATAAAAACTATGATGG + Intergenic
994867035 5:105288124-105288146 TTTATCTAAAGATACTATGATGG - Intergenic
995430774 5:112073924-112073946 TTTATATAAAAAAACTTTATTGG + Intergenic
995746030 5:115404779-115404801 TTTTTTTAAAAAAACTTTGTGGG + Intergenic
995783321 5:115801198-115801220 TTTAGAAAACAAAAGTATGTGGG - Intergenic
996390586 5:122956414-122956436 TACAGCTAAAAAAAATATGGTGG - Intronic
997119457 5:131159041-131159063 ATTAGCTTAAAAATCTAAGTTGG + Exonic
997521212 5:134525613-134525635 TTTAGAAAAAAAAAATGTGTTGG - Intronic
998650256 5:144111590-144111612 TTGAGCAAAAAAAACAAAGTTGG + Intergenic
999013518 5:148070289-148070311 TTTAGCTAACACAACTTTTTTGG + Intronic
1000802397 5:165744870-165744892 TTTTGCTTTAAAAACTTTGTTGG - Intergenic
1000885719 5:166745239-166745261 TTTAGCCACATAAACTAAGTTGG - Intergenic
1004003328 6:11615666-11615688 TTTAGAAAAAAAAAGTATTTGGG + Intergenic
1004504453 6:16236834-16236856 TATAGCTAATGAAACCATGTGGG + Intergenic
1005385577 6:25280935-25280957 TTTAGCTAATAATACTTTGGAGG + Intronic
1006146893 6:31964817-31964839 TTTAGACAAAATAACTATATTGG + Intronic
1007296843 6:40829759-40829781 TCTAGATACAAAAACTTTGTTGG - Intergenic
1007868359 6:45001953-45001975 TTTAACTGAAAAAAATATGCTGG - Intronic
1008191050 6:48457900-48457922 TTTAGATAAAATAATTAAGTTGG + Intergenic
1008627256 6:53329521-53329543 TTTGTCTAAGAATACTATGTCGG + Intronic
1008947737 6:57117368-57117390 TGTAGTTAAATAAAATATGTAGG + Intronic
1009793144 6:68430358-68430380 TTTAGCAAAAATAAATTTGTGGG + Intergenic
1010083905 6:71893357-71893379 TTTAGCACAAAAAGCAATGTGGG + Intronic
1011681657 6:89789305-89789327 TTTAGTTAAGAAAAATATGCTGG - Intronic
1012496487 6:99839025-99839047 TTTAACTTAAAGAAATATGTTGG + Intergenic
1012637426 6:101561929-101561951 CTGAGCTAGAAAAAATATGTGGG + Intronic
1012831980 6:104215566-104215588 GTTTGATAAAAAAACTATGTGGG - Intergenic
1013064758 6:106673068-106673090 TTTAGACAAAATAAATATGTTGG + Intergenic
1014474777 6:121858784-121858806 TTAAGCTAAATAAAATATATTGG - Intergenic
1014928398 6:127303264-127303286 TTTAGCTTATAAAACTATAAAGG + Intronic
1015140506 6:129925826-129925848 TTTAGTTAAAAAAAATCTATTGG + Intergenic
1015734786 6:136387283-136387305 TTTAGCTAAAAAAATTACCTGGG - Intronic
1016248423 6:142015402-142015424 TTGAGATAAAATAAATATGTGGG + Intergenic
1016756968 6:147697877-147697899 TTTAGCTAAAAAAACTATGTAGG + Intronic
1018505865 6:164467609-164467631 TTTATCCATAAAGACTATGTTGG - Intergenic
1019026261 6:168965909-168965931 TTTAGTTAAATAAACTAATTTGG - Intergenic
1020409943 7:7880786-7880808 TTTACCTTAAAAAACTATTACGG - Intronic
1020911734 7:14139867-14139889 TCTAACTTAAAAAACTAGGTAGG + Intergenic
1020950201 7:14666220-14666242 TTTAACAAAAAAAGATATGTTGG - Intronic
1021042104 7:15874982-15875004 TTTAGTTAAAAAGACTTGGTAGG + Intergenic
1021290174 7:18833691-18833713 TTTAGCTGAAACAACTTTCTGGG + Intronic
1023246464 7:38210216-38210238 TCTACCAAAAAAAACTATATGGG + Intronic
1023255173 7:38305902-38305924 TTTAGAGAATAAAAATATGTTGG + Intergenic
1026552529 7:71380614-71380636 TTTAAGTAAAAAAACTGGGTTGG - Intronic
1027140424 7:75653031-75653053 TTTGGCTAAACAATATATGTGGG + Intronic
1028168847 7:87571455-87571477 TTCAGCTACTATAACTATGTAGG + Intronic
1028481925 7:91316434-91316456 TTTATTTTAAAAAACAATGTTGG - Intergenic
1028982032 7:96977933-96977955 TTTAGTTAAAAAAATTTTTTTGG - Intergenic
1030276776 7:107729678-107729700 TTTAGCTCATCAAAATATGTGGG + Intergenic
1030399005 7:109025441-109025463 TTCATATAAAAAAACTATCTGGG + Intergenic
1030516258 7:110542242-110542264 TTTATCTAAAAGACCTAAGTAGG - Intergenic
1030695240 7:112577915-112577937 TGTAGCTGGAAAAACTATGGGGG + Intergenic
1031752984 7:125600875-125600897 TTTATTTAAAAAAACTATACAGG + Intergenic
1032137966 7:129298987-129299009 TGTAGCGAAAAAAAGTATATAGG + Intronic
1032830721 7:135622772-135622794 TTTAGCCAAGAAAACCATGTGGG + Exonic
1033764993 7:144478956-144478978 TTTAGCTAAAACATTTCTGTTGG - Intronic
1035550350 8:518755-518777 TTAAGCTAAAAAAAAAATGGTGG - Intronic
1036803757 8:11812665-11812687 TTTAGCTACATATAGTATGTGGG + Intronic
1038077648 8:24094984-24095006 TTCTGTTGAAAAAACTATGTGGG - Intergenic
1039188449 8:34944535-34944557 TTTACCTGAAAAATCAATGTAGG + Intergenic
1042229704 8:66543273-66543295 TTTAATAAAAAAAACTCTGTGGG - Intergenic
1042560032 8:70066672-70066694 TTAAACTAACAAATCTATGTTGG - Intronic
1043947441 8:86270307-86270329 CTTGGCTTAAAAAACTATTTAGG - Intronic
1044132088 8:88536120-88536142 TTTTACTAAACAAACTTTGTTGG + Intergenic
1044880056 8:96714548-96714570 TTTAAATAAAAAAATTATGTTGG + Intronic
1046181101 8:110648611-110648633 ATTGGCTGAAAAAAATATGTTGG - Intergenic
1049430077 8:142558215-142558237 TTTAGCTACACAAATTCTGTGGG - Intergenic
1050211658 9:3265401-3265423 TTTAGCTGATAAACCTCTGTGGG - Intronic
1050587524 9:7128402-7128424 TTTGGCCAAAAAAAGAATGTGGG - Intergenic
1051315748 9:15829617-15829639 ATATGCTAAAAGAACTATGTAGG + Intronic
1052485220 9:29088753-29088775 TTTATCTGAAAAAATTATTTTGG + Intergenic
1055505805 9:76947876-76947898 TTCAGCACAAAAAAGTATGTGGG - Intergenic
1055743802 9:79420078-79420100 TTTAACAAAAAGAACTAAGTTGG - Intergenic
1057044490 9:91874442-91874464 TTTATCTAGAAAAACTAAGTTGG + Intronic
1058462204 9:105193330-105193352 TTAACCTATAAAAACTATGTGGG + Intergenic
1058600390 9:106663133-106663155 TTTGGCTTATAAAACTGTGTTGG + Intergenic
1059063273 9:111055616-111055638 TTTCTCTTAAAAAGCTATGTTGG + Intergenic
1059782118 9:117540984-117541006 TTTTGTTAAAGAAACTATTTTGG + Intergenic
1060364201 9:122992793-122992815 TTTAGATAAAATAAATATTTAGG - Intronic
1186098536 X:6129800-6129822 TTTAAAAAAAAAAACTATTTTGG + Intronic
1187625854 X:21112935-21112957 TTTTGAGAAAAAAAATATGTTGG - Intergenic
1187846834 X:23547454-23547476 TTTATTTAAAAAAATTTTGTGGG - Intergenic
1188219997 X:27529828-27529850 TTCAGCTAAACAAAATATCTTGG + Intergenic
1188414136 X:29911605-29911627 ATTAGCTAATAAAACAATGGAGG + Intronic
1189002453 X:36960932-36960954 TTTAACTAATAATATTATGTTGG - Intergenic
1189683521 X:43540805-43540827 TTTTGCTAAAAATAATATTTTGG + Intergenic
1190580413 X:51888283-51888305 TTTAATTAAAAAAATTTTGTGGG - Intronic
1191602919 X:63030202-63030224 ACTAGCTAAAAACACTATGATGG - Intergenic
1192291898 X:69806449-69806471 TTTATCTAACAAAAATTTGTTGG + Intronic
1193141217 X:78029107-78029129 TGTAACTAAAAAATATATGTAGG + Intronic
1193385495 X:80866573-80866595 TTTAGCTTAATATTCTATGTTGG + Intergenic
1193581914 X:83275313-83275335 TTTTGCTAAAAATACTTTGTGGG - Intergenic
1194054032 X:89108643-89108665 TTTATCTAGCAAAACAATGTAGG + Intergenic
1194254822 X:91622962-91622984 TCAAGCTAAAGAAAGTATGTTGG - Intergenic
1194380058 X:93180435-93180457 TTTAGTTAAAAAATATAAGTAGG + Intergenic
1197085661 X:122471365-122471387 TTTAGCTAAAAATATTGTTTTGG - Intergenic
1197155651 X:123267165-123267187 TTTAGCTAAAAACAAAATGTAGG + Intronic
1199369617 X:147031941-147031963 TTTAGATAAAAACACTGTGAAGG - Intergenic
1199402711 X:147418054-147418076 TTTACCTAGGAAAAATATGTGGG - Intergenic
1199587387 X:149430551-149430573 TGGAGCTAAAACAACTATATAGG + Intergenic
1199816188 X:151398629-151398651 TGTATCTAATAAAAATATGTTGG - Intronic
1199906278 X:152235202-152235224 AATAGCTACAAAAAGTATGTAGG - Intronic
1200573609 Y:4862565-4862587 TCAAGCTAAAGAAAGTATGTTGG - Intergenic
1201169755 Y:11246468-11246490 ATTTGCTAAAAAAATTATATAGG - Intergenic
1201361506 Y:13155957-13155979 TTTAACTCCAAAACCTATGTAGG + Intergenic