ID: 1016759413

View in Genome Browser
Species Human (GRCh38)
Location 6:147720476-147720498
Sequence GAGCTGGGGGAGACCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 526}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016759413_1016759423 28 Left 1016759413 6:147720476-147720498 CCTTCCACGGTCTCCCCCAGCTC 0: 1
1: 0
2: 0
3: 40
4: 526
Right 1016759423 6:147720527-147720549 TTGTGTAGAAACGATACCAAAGG 0: 1
1: 0
2: 1
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016759413 Original CRISPR GAGCTGGGGGAGACCGTGGA AGG (reversed) Intronic
900131284 1:1088312-1088334 GTCCTGGGGGAGGCCGTGGGGGG - Intronic
900140319 1:1137039-1137061 GAGCTGGGGGAGCCCAGGGCGGG + Intergenic
900488984 1:2936968-2936990 GGGCTGGGGGAGGCCAGGGATGG - Intergenic
900498018 1:2985197-2985219 GGGCTGAGGGAGACCCTGGAAGG + Intergenic
900564068 1:3323865-3323887 GAGCCGGGGGAGCCCCTGGGGGG - Intronic
900646053 1:3709185-3709207 CAGCTGGGGGAGCCCGTGGCTGG - Intronic
900712829 1:4125251-4125273 CAGCTGGGTGACACTGTGGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901387739 1:8922131-8922153 GAGCAGGGGCATACGGTGGAGGG - Intergenic
902032975 1:13436327-13436349 GAGGTGGGGCAGACCCTGGTGGG - Intergenic
903034645 1:20485976-20485998 GAGGCAGGGGAGACGGTGGAAGG + Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903317037 1:22516156-22516178 GAGATGGGGGAGTGTGTGGATGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904160289 1:28518120-28518142 GGGCTGGGGGAGCCCTTGGCCGG - Intronic
904652388 1:32014802-32014824 GAGCGGGGAGGGACCGTGGGAGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905074096 1:35254358-35254380 GAGCTTTGGGAGGCCGAGGAAGG + Intergenic
905242885 1:36592564-36592586 TAGCTTGGGGAGACTGTGGGAGG + Intergenic
905473504 1:38209841-38209863 GAGGTGGCGGGGACTGTGGAAGG + Intergenic
905732018 1:40304138-40304160 TAGGTGGGGGACCCCGTGGAGGG - Intronic
905922823 1:41730525-41730547 ATGCTGGGGGAGACCCTGGAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906471242 1:46132884-46132906 AGGCTGGGGGAGAGCGCGGATGG - Intronic
906522643 1:46476595-46476617 GTGCTGGGGTACACCATGGAGGG + Intergenic
906684085 1:47751781-47751803 GAGCTGGGGCTGAGCGTTGAAGG + Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907512676 1:54973414-54973436 GAGCTGGGAGGGTCTGTGGATGG - Intergenic
907516049 1:54994124-54994146 GAGCAGGGGGAGAGAGTGGCAGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910449236 1:87329494-87329516 GGGCTGGTGGGGACCGTAGAGGG + Intronic
911517983 1:98891590-98891612 GACCTGGGGGTGAGGGTGGAAGG + Exonic
912332873 1:108835176-108835198 GAGCTGGGGGAGACAGGGGTGGG - Intronic
912509918 1:110182295-110182317 GAGATGGGGAAGACAGTGGAGGG + Intronic
912521683 1:110250144-110250166 GAGGTGGGGGAGCCCGGGAAAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913113555 1:115677091-115677113 GAGCATGGGGAGGCAGTGGATGG + Intronic
913283900 1:117210293-117210315 GAGCTGGGGGGGCCTGGGGAGGG + Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915064464 1:153213195-153213217 GAGCTGAGGAAGACTGTGGTAGG + Intergenic
916930721 1:169575750-169575772 GAGATGGAGGACACCGTGGGAGG + Intronic
918119079 1:181521863-181521885 GAGGTGGGGGAGGCCATGGCAGG + Intronic
919492692 1:198225660-198225682 GAGTTGTGGGAGACGGTGGGTGG - Intronic
919847157 1:201649368-201649390 GAGCTGGTGGTGACCGTGCTGGG + Exonic
920441608 1:205984633-205984655 GAGGTGGGGAAGACCATGGAAGG - Intronic
920611065 1:207438403-207438425 GTGCTATGGGAGACAGTGGAAGG + Intergenic
921338086 1:214108032-214108054 GAGGTGGGGGAGGCCCTGGCAGG - Intergenic
922326413 1:224532351-224532373 GAGATGGGGGAGCCTGTGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
922752291 1:228075956-228075978 GAGCTGGAGGAGGCTGTGCAGGG - Exonic
922873450 1:228921297-228921319 GAGGTGGGGGAGAGCAGGGAGGG - Intergenic
923407709 1:233679355-233679377 CAGCTGGTGGAGGCCGTGAAGGG + Intergenic
924030359 1:239879780-239879802 CAGCTGTGTGTGACCGTGGAGGG - Intronic
924440612 1:244082437-244082459 GAGCAGTGGGAGGCCATGGAAGG + Intergenic
924685474 1:246285114-246285136 GACCTGGGGGACAGGGTGGAGGG - Intronic
1062805871 10:419064-419086 GAGCTCATGGAGACCGGGGATGG - Exonic
1062892699 10:1076431-1076453 GAGCTTTGGGAGACCGAGGTGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063142011 10:3263982-3264004 GAGTTAGGGGAGTCCGTGAAGGG - Intergenic
1063353883 10:5380548-5380570 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063353891 10:5380583-5380605 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063353899 10:5380618-5380640 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1063353907 10:5380653-5380675 GTGCTGTGGGAGACCGAGGTGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1066068321 10:31778660-31778682 GGGGTGGGGGTGACGGTGGAGGG - Intergenic
1067231401 10:44413487-44413509 GAGCTGGGGAAGGCCATGAAGGG + Intergenic
1067571713 10:47376627-47376649 GGGCTGGGGGAGAAGGAGGATGG - Intronic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068927632 10:62556641-62556663 GATCTGGGGGAGGCCTTGGATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070121233 10:73579195-73579217 GCGCTGTGGGAGGCCGAGGATGG - Intronic
1070696559 10:78568253-78568275 GAGCTGTGGGAGGCTGAGGAGGG + Intergenic
1070976583 10:80610241-80610263 GAGCTGAGGGACACTGGGGAAGG - Intronic
1071262611 10:83934388-83934410 AACCTGGAGGAGACCGTGGATGG - Intergenic
1071471224 10:85985383-85985405 CAGTTGGGGGAGACCGAGGTGGG - Intronic
1071573032 10:86708346-86708368 GAGGTGGGGGAGCCCATGGGAGG + Intronic
1072160765 10:92764226-92764248 GAGCTGGGGGTGAGCGGGAATGG - Intergenic
1072551312 10:96479716-96479738 TAGCTGGGGTAGACAGTGAAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072745710 10:97937822-97937844 GAGGTGGGGGACCCTGTGGATGG - Intronic
1073017813 10:100415854-100415876 GAGCTGGGGCAGAGAGTGAAGGG - Intergenic
1073289626 10:102407131-102407153 GAGCTGGGGTAGGCCCTGGGTGG - Intronic
1075014550 10:118900678-118900700 GAGCTGGGTGAACCCATGGAAGG - Intergenic
1075709119 10:124521329-124521351 GGGCTGGGGGTGGCCCTGGAAGG - Intronic
1075894672 10:125984508-125984530 GAGATGGGGAAGACTGTGGGTGG + Intronic
1076109426 10:127849493-127849515 GCCCTGGGGGAGACCGAGGGGGG + Intergenic
1076740447 10:132480363-132480385 GCCCTGAGGGAGACCGAGGAAGG + Intergenic
1076841914 10:133050018-133050040 TGGCTTGGGGAGATCGTGGATGG - Intergenic
1076875635 10:133214324-133214346 GTGCTGGGGGAGAGCTGGGAGGG - Intronic
1076912916 10:133401146-133401168 GAGGTGGGGGACTGCGTGGAAGG + Intronic
1077060855 11:617323-617345 CGGCTGGGGGAGAGGGTGGAGGG + Exonic
1077171030 11:1165813-1165835 AAGCTGGGGGAGCCTGTGGGAGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079097150 11:17518345-17518367 GAGGTGGGGGAGATAGTTGATGG + Intronic
1080790084 11:35514738-35514760 GAGCTTTGGGAGGCCGTGGTGGG + Intronic
1081758451 11:45560763-45560785 GAGCTGGGGGTCAGGGTGGACGG - Intergenic
1083211988 11:61193930-61193952 GAGCTGGGGCTGAAGGTGGAGGG - Intergenic
1083397552 11:62401924-62401946 GAGCAAGGGGAGGCCGTGGCAGG + Intergenic
1084008260 11:66334359-66334381 GAGTTGGGGGAGAGAGGGGATGG + Intronic
1084261908 11:67984311-67984333 GAGCCGGGGGAGAGAGTGGCTGG + Intergenic
1084481154 11:69420920-69420942 CTGCTGGGGGAGCCCCTGGATGG + Intergenic
1084661972 11:70551324-70551346 GAGATGGGGGAGGCGGTGGGAGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085844334 11:80048513-80048535 TAGCTGTGGGAGACAGGGGATGG + Intergenic
1087063972 11:94010225-94010247 GAGCTTGAGGAGAGAGTGGAGGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088821321 11:113460259-113460281 GGGCTGGGGGTGACTGGGGAGGG - Intronic
1089344292 11:117780693-117780715 GCGCTGGGGGAGCCCGCGGCCGG + Exonic
1089496797 11:118912111-118912133 GAGCTGGGGCAGACTCTTGAGGG - Intronic
1089641113 11:119847838-119847860 GAGCTGGAGGAAACCCTGAAGGG - Intergenic
1089658344 11:119968792-119968814 GAGCTGGGGGAGACTGCAGGTGG + Intergenic
1090131649 11:124148397-124148419 GAGTTGGGGAAGACGGAGGATGG - Intergenic
1090363119 11:126186915-126186937 GAGCTGGTGGAGACCGTCCGAGG + Intergenic
1090428885 11:126629551-126629573 GATCTGGAGGAGCACGTGGAAGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090998750 11:131890434-131890456 GTGCAGGGGGAGACAGTGGTAGG + Intronic
1091176526 11:133563315-133563337 GAGATGCTGGAGACCATGGAGGG - Intergenic
1091191805 11:133701873-133701895 GTGCTGGGGGAGACCCTGCGGGG - Intergenic
1091237449 11:134031583-134031605 GAGATGAGGGAGACGGGGGAAGG - Intergenic
1091871435 12:3894467-3894489 GAGCTGGGAAAGGCTGTGGAAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1097030313 12:56085140-56085162 GAGCTGGCGCAGAGCGTGGCTGG - Exonic
1097057338 12:56257997-56258019 GAGTGGGGGGCGTCCGTGGAGGG + Intronic
1097232011 12:57518543-57518565 GAGATGGGGATGACCTTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100539907 12:95548414-95548436 GAGCTGGGGGAGAACGGGCGCGG - Intronic
1101119429 12:101563957-101563979 GAGATGGGGGAGACAGAAGAGGG - Intergenic
1101767789 12:107718869-107718891 GAGCTGGTGGTGATGGTGGATGG - Intergenic
1101977265 12:109370440-109370462 GTGATGGGGGAGGCTGTGGAAGG - Intronic
1102533150 12:113561639-113561661 GGGCTGGGCCAGACCGGGGAGGG + Intergenic
1103436817 12:120933111-120933133 GAGCTGGGGTTGACCGGGCAGGG + Intergenic
1103521087 12:121537428-121537450 GAGCTGGGGGCGGCCGGGGGCGG - Intronic
1103970436 12:124667458-124667480 GAGCTGTTGGAGAGCGTCGAAGG - Intergenic
1104614704 12:130258017-130258039 AAGCTGGGGGAGACTGAGGCAGG + Intergenic
1104968906 12:132522341-132522363 GAGCTGGGGGACGGTGTGGAGGG + Intronic
1105000328 12:132686817-132686839 GCGCTGGGGGAGGCCGAGGCGGG - Intronic
1107031963 13:35862386-35862408 GAGCTGGGGGAGACCTCAAAGGG - Intronic
1107810294 13:44193870-44193892 GAGCTGTGGCAGACACTGGAGGG + Intergenic
1108582369 13:51838322-51838344 GAGCTGGGGAAGACAGTGTCCGG - Intergenic
1110190851 13:72727523-72727545 GCGGTGCGGGAGACCATGGACGG - Exonic
1110994643 13:82091286-82091308 GAGCTGGGAGAGAAAGTGGGTGG + Intergenic
1111062812 13:83045523-83045545 GGGTTGGGGGAGGCGGTGGAGGG - Intergenic
1113785938 13:113002112-113002134 GGGCTGGGGGATGCCGGGGATGG + Intronic
1113808537 13:113123669-113123691 GAGCAGGGGGAGACCCTCGTGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114532219 14:23403203-23403225 GAGCTGGCGGAGTGAGTGGAGGG + Intronic
1114535445 14:23419432-23419454 GAGGTTGGGGAGACTGTGGTGGG + Intronic
1115697364 14:35913676-35913698 GAGCTGGGGAACAAGGTGGATGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116487962 14:45474381-45474403 GAGTTGGGGGAGACCTGGAAAGG - Intergenic
1116996538 14:51330591-51330613 GAACTGGGGGACGCCGTGCAAGG + Intergenic
1117353710 14:54903527-54903549 GCGCTTGGGGAGACCGAGGCGGG + Intergenic
1119148956 14:72340733-72340755 GAGCTCTGGGAGACTGTGAAAGG + Intronic
1119732058 14:76957218-76957240 GAGCTGGGGGTGCCAGGGGAGGG - Intergenic
1120833469 14:89018947-89018969 GAGCTTTGGGAGACTGAGGAGGG - Intergenic
1120987151 14:90344109-90344131 GCTTTGGGGGAGACAGTGGATGG - Intergenic
1121144729 14:91574067-91574089 GCGCTGCGGGCGACCGTGGGTGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122795040 14:104201771-104201793 GAGGCGGTGGAGACTGTGGATGG + Intergenic
1122825756 14:104369673-104369695 GAGCTGAGGGAGACTGGGGGTGG - Intergenic
1122911079 14:104827822-104827844 GGGCTGGGGGAGGCCAGGGACGG + Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1122917150 14:104864652-104864674 GAGCTGGGGGCGATGGTGGTGGG - Intergenic
1123149061 14:106164206-106164228 GAGCTGGGGAAGGCCATGGATGG - Intergenic
1123973159 15:25528020-25528042 GAGGTGGTGGAGTCAGTGGAGGG + Intergenic
1123973167 15:25528055-25528077 GAGGTGGTGGAGTCAGTGGAAGG + Intergenic
1123973174 15:25528090-25528112 GAGGTGGTGGAGTCGGTGGAAGG + Intergenic
1123973183 15:25528125-25528147 GAGGTGGTGGAGTCGGTGGAGGG + Intergenic
1123973191 15:25528160-25528182 GAGGTGGTGGAGTCGGTGGATGG + Intergenic
1123973200 15:25528195-25528217 GAGGTGGTGGAGTCGGTGGAGGG + Intergenic
1123973209 15:25528230-25528252 GAGGTGGTGGAGTCGGTGGAGGG + Intergenic
1123973218 15:25528265-25528287 GAGGTGGTGGAGTCGGTGGAGGG + Intergenic
1123973227 15:25528300-25528322 GAGGTGGTGGAGTCGGTGGAGGG + Intergenic
1123973237 15:25528335-25528357 GAGGTGGTGGAGTCGGTGGAGGG + Intergenic
1124586398 15:31013255-31013277 GAGCTTTGGGAGACCAAGGAGGG - Intronic
1124922341 15:34039008-34039030 GAGCTCGGGGAGGCCGTGGGCGG - Exonic
1124962506 15:34409454-34409476 GTGCTGTGGGAGAACGTGGTTGG + Intronic
1124979130 15:34555676-34555698 GTGCTGTGGGAGAACGTGGTTGG + Intronic
1125598153 15:40900578-40900600 GAGCTGGGGGTCACGGTGGCGGG - Exonic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127029745 15:54848876-54848898 GAGCTGGATGAGAGAGTGGAAGG + Intergenic
1127038990 15:54952490-54952512 GAGAAGGGGGAAACCATGGAGGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127859694 15:62983009-62983031 CTGCTGGGGGAGACTGTGGCGGG + Intergenic
1128528423 15:68428247-68428269 GAGCTGGGGGTGTTGGTGGAAGG + Intronic
1129150606 15:73685203-73685225 GAGATGCGGGCGACGGTGGAGGG + Intronic
1129660247 15:77549288-77549310 CTGCTGCGGGATACCGTGGAAGG - Intergenic
1129782075 15:78279241-78279263 AAAATGGGGGAGACGGTGGAGGG - Intronic
1130882941 15:88070649-88070671 GGGCTGGGGGAGTGGGTGGAGGG - Intronic
1131116653 15:89800084-89800106 GGGCTGCAGGAGACAGTGGATGG - Intronic
1131173998 15:90198811-90198833 GAGATGGGGGAACCCTTGGAGGG + Intronic
1131259774 15:90882328-90882350 GAGCTGGGGGACAGGGTGGAGGG - Exonic
1132497532 16:270902-270924 GAGCTGGTGGAAACCGAGGCGGG + Intronic
1132600795 16:771944-771966 GTGCTTTGGGAGACCGAGGAGGG + Intronic
1132951130 16:2563040-2563062 GAGCTGGGAGAGACCGGGGCGGG + Intronic
1132963220 16:2637130-2637152 GAGCTGGGAGAGACCGGGGCGGG - Intergenic
1132975580 16:2709680-2709702 GCCCTGGGGGACACCGTGAATGG - Intergenic
1133027661 16:2995675-2995697 GGGCTGGGGGAGAATGTGGGTGG + Intergenic
1133221471 16:4320854-4320876 GTGCTGGGGGAGGCCGGGGCTGG - Intronic
1133682723 16:8135480-8135502 GAGATGGGGAAGGCTGTGGATGG - Intergenic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1134761807 16:16721097-16721119 ATGCCGGGGGAGAGCGTGGATGG + Intergenic
1134984251 16:18638073-18638095 ATGCCGGGGGAGAGCGTGGATGG - Intergenic
1135349704 16:21718348-21718370 GAGATGGGGAAGACCATGGGAGG + Intronic
1136382313 16:29901303-29901325 GAGCTGGGGGTGTTCGTGGTGGG + Exonic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138460393 16:57144277-57144299 GAGCTGGGGGTGAGGGTGGTGGG + Intronic
1139477182 16:67208598-67208620 GGGCTGGGGGAGCCTGTGCAGGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140321956 16:73961328-73961350 GCGCTGGGGGAGGCCGAGGTGGG - Intergenic
1141589093 16:85055958-85055980 GGACTGGGGGAGACACTGGAGGG - Intronic
1141597338 16:85105358-85105380 CAGCTGGAGGAGACTGTGGATGG - Exonic
1141622106 16:85241865-85241887 GGGCTGGGGGTGCCCGGGGAGGG - Intergenic
1142399250 16:89850669-89850691 TGGGTGGGGGCGACCGTGGAGGG + Intronic
1142678873 17:1533760-1533782 GAGCTGGAGGTGACCCTGGGAGG - Intronic
1142682977 17:1561484-1561506 GAGATGGGGGAGACCAGGGCAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143152880 17:4818120-4818142 GAGGTGGGGGAGAGCATGGAAGG + Intronic
1143854498 17:9838762-9838784 GAGAATGTGGAGACCGTGGAAGG + Intronic
1143863811 17:9909625-9909647 GACCTGGGAGGGACCCTGGAAGG - Intergenic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144635937 17:16909147-16909169 GAACTGGGGGTGACCGTCAAAGG - Intergenic
1144862997 17:18317482-18317504 GAACTGGGTGAGACAGAGGAAGG + Exonic
1144947304 17:18976534-18976556 GGGCTGGAGGAGACCCTGGGTGG - Intronic
1146181907 17:30703820-30703842 GAGCTGAGTGAGCCCCTGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146535458 17:33646918-33646940 GAGCTGGGGGAGAGCGGTGGAGG + Intronic
1147323908 17:39661332-39661354 TGGCTGGGGTAGACCATGGATGG + Intronic
1147702649 17:42405557-42405579 GCGCTGTGGGAGACCGAGGCAGG + Intronic
1148110069 17:45139308-45139330 GAGGTGGGGGTGAGGGTGGAGGG + Intronic
1148547121 17:48527295-48527317 GGGCGGGGGGAGTCCGAGGATGG - Intergenic
1148759264 17:49991138-49991160 GGGATGGGGGAGAGTGTGGAGGG - Exonic
1148912272 17:50949414-50949436 GTGCTGGGGGAGGCCGAGGTGGG - Intergenic
1150267783 17:63842333-63842355 GAACTCCGGGAGACGGTGGAGGG - Intronic
1150840397 17:68601046-68601068 GGGCGGGGGGCGACCGCGGAGGG + Exonic
1151876533 17:76870329-76870351 GAGCTGGTGCAGGCCGTGGGTGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152234873 17:79133288-79133310 GAGCTGGTAGTGACCATGGATGG - Intronic
1152426111 17:80219746-80219768 GGGTTGGGGGAGACGGTGGTGGG + Intronic
1153914244 18:9732085-9732107 GAGCTGAGGGAGACGGAGGCTGG - Intronic
1155484323 18:26325551-26325573 GAGTTGGGGGAGAGAGAGGAAGG + Intronic
1156254810 18:35384847-35384869 GAACTCTGGGAGACCGAGGAGGG + Intergenic
1158164185 18:54520471-54520493 GTGCTGGAGTAGACCCTGGAAGG - Intergenic
1158936883 18:62373037-62373059 GGGATGGGGCAGACTGTGGAAGG - Intronic
1160126449 18:76177020-76177042 GAGCTGGGGAAGGCCATGAAGGG - Intergenic
1160261141 18:77295275-77295297 GAGCGAGGGGAGACTTTGGAAGG + Intergenic
1160410689 18:78673641-78673663 GAGCTGGGGGAGGCAGGGAAGGG + Intergenic
1160738088 19:673920-673942 GGCCTGGGGGAGACTGAGGAAGG - Intergenic
1161104022 19:2434466-2434488 GAGCTGGAGGAGGCCATGGCCGG - Exonic
1162444310 19:10712887-10712909 GAGCTGGGGCAGGGCATGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162934614 19:13975493-13975515 GAGTTGAGGGGGACAGTGGAAGG + Intronic
1162962468 19:14136210-14136232 GGGCTGGGGGAGATCGGGGTTGG + Intronic
1162976931 19:14211971-14211993 GAGCTGAGTGAGCCCCTGGAAGG + Intergenic
1163469439 19:17487918-17487940 GAGCAGGAGGAGCCCGAGGAGGG - Intronic
1163484401 19:17577442-17577464 CGGCTGGTGGAGGCCGTGGACGG + Exonic
1163554197 19:17983282-17983304 TAGCTGGTGGAGGCCCTGGAGGG + Intronic
1163632923 19:18426278-18426300 GAGCTGGAGGCGGCTGTGGAAGG + Intronic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1165116091 19:33529649-33529671 AGGCTGGGGGAGACCCTGCAGGG + Intergenic
1165859178 19:38898354-38898376 GAGATGGGGGAAAGGGTGGAGGG - Intronic
1166053424 19:40274683-40274705 GAGCCGGGGGAGACCTGGGGAGG + Intronic
1166062622 19:40336156-40336178 GAGCTGGGCGTGACCGTGGTGGG - Exonic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166297047 19:41894569-41894591 CAGCTGGGGAAGACAGGGGAGGG - Intronic
1166743924 19:45130915-45130937 GGGCTGGGGGACACAGTGGGAGG - Intronic
1167161888 19:47773316-47773338 GAGATGGGGAAGACTGAGGAAGG + Intergenic
1167223066 19:48216099-48216121 GAAATGGGGGAGATTGTGGATGG - Intronic
1167243307 19:48358494-48358516 GGGATGGGGGAGACCGTGGTGGG - Intronic
1167341537 19:48919257-48919279 GAGTTTGGGGACACCGGGGAGGG + Exonic
1167506404 19:49873252-49873274 GAGCTGTGGGAGGCCGTGGTGGG - Exonic
1167602356 19:50461736-50461758 GACCTGGGCGAGAGGGTGGACGG - Intronic
1167687187 19:50963643-50963665 CAGCTGGGGAAGACTGTGGGAGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168315581 19:55483445-55483467 GGGCTGGGGGCGGCCGTGCAAGG + Exonic
1168595810 19:57675526-57675548 GAACTGTGGGAGGCCGAGGAGGG - Intronic
925048586 2:793531-793553 GAGCTGGGGAAGGCCTTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925577419 2:5374854-5374876 GAACTGCTGGAGACCGTAGAAGG - Intergenic
926059158 2:9794463-9794485 GAGATGGGGGAGAGGGTGGCAGG - Intergenic
926350253 2:11987472-11987494 GAGCTGGAGGTGACTGGGGAGGG + Intergenic
926621288 2:15049185-15049207 GAGCTGGGGGTGCAGGTGGAAGG - Intergenic
927768992 2:25841699-25841721 TAGCTTTGGGAGACCGAGGAGGG + Intronic
927810919 2:26179819-26179841 GAGCTGGGGGAGGATGTGGCAGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928538503 2:32262526-32262548 GTGCTTGGGGAGACTGAGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928987671 2:37196825-37196847 GAGCTGGGTGGGACCGCGGCAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931235595 2:60410299-60410321 GACCTGGAGGAGACCTTGGCCGG - Intergenic
931692765 2:64849296-64849318 GAAATGGGGGAGTCTGTGGAAGG + Intergenic
931902772 2:66807584-66807606 GAGGTGGGGGAGATGGAGGAGGG + Intergenic
932474473 2:71993331-71993353 GAGCTTTGGGAGACCGAGGCAGG - Intergenic
932564129 2:72894949-72894971 TAGCTGGGGGAGCCGATGGAGGG + Intergenic
932714357 2:74090643-74090665 GGGCTGGGGGAGGCCCTGCAGGG - Intronic
933761268 2:85673830-85673852 GAGCTTGGGGAGACAGAAGAAGG - Intergenic
935250551 2:101256401-101256423 GAGCTGGGGAAGTCAGTAGAGGG + Intronic
935270863 2:101433058-101433080 CAGATGGGGAAGACCGGGGAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937103075 2:119286504-119286526 GAGCTGGGGGAGACAGGAGGAGG + Intergenic
937182797 2:120011665-120011687 GAGGTGGGGGAGCCACTGGAAGG - Intergenic
937338245 2:121075161-121075183 GGGTCGGGGGAGACCCTGGAAGG - Intergenic
937985062 2:127634701-127634723 GAGCTGGGGGAGGGCGTGGCTGG + Intronic
938097755 2:128474571-128474593 GAGCTGGGAGGGACCAGGGAAGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942276404 2:174326832-174326854 GACCTGGGGGAGGCGGAGGAGGG - Intergenic
942331334 2:174827895-174827917 GAGGTGGGGAGGACTGTGGAAGG + Intronic
942735408 2:179105507-179105529 GAACTGGGGGTGACGGTGAAGGG + Exonic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944301668 2:198130949-198130971 GAGCTGTGGGAAGCCCTGGAAGG - Intronic
944413463 2:199463044-199463066 GAGCTGGGGGAGTCGTTGGTGGG + Intronic
944630684 2:201620784-201620806 GAGCTGGGGAAGGCCGTGAAAGG - Exonic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945948152 2:216013697-216013719 GGGCTGGGGGAGGGCGGGGAGGG + Intronic
946197035 2:218039709-218039731 GAGCTGGGGCAGTCCATGAATGG - Intronic
946213786 2:218167808-218167830 GAGCTGGGGCAGTCCATGAATGG + Intergenic
946700762 2:222410922-222410944 GAGCTACGGGTGACAGTGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169139746 20:3220800-3220822 GCGCTTGGGGAGGCCGAGGAGGG - Intronic
1170230492 20:14041897-14041919 GAGATGGGGGAGACTCTTGAGGG + Intronic
1170562504 20:17569679-17569701 GGGCGGGGCGAGGCCGTGGAGGG - Intergenic
1170595889 20:17805459-17805481 GAGCTGGGGGCAAGCGGGGAGGG + Intergenic
1170857849 20:20074003-20074025 GAGCTGCGGGAGAGCCTGCAGGG - Intronic
1171017146 20:21552435-21552457 GGGCTGAGAGAGACCGTGGTGGG + Intergenic
1171387671 20:24781024-24781046 GACCTTGGAGAGACCTTGGAGGG - Intergenic
1172035644 20:32008917-32008939 GAGCTGGGGAAGGCCATAGAGGG + Intergenic
1172385510 20:34531397-34531419 GAGCTGGAGGAGACCTGAGACGG - Intronic
1172997949 20:39084406-39084428 AAGGTGAGGAAGACCGTGGAGGG - Intergenic
1174104700 20:48153888-48153910 GAGCTCAGGGAGAGAGTGGATGG - Intergenic
1174136417 20:48383029-48383051 GAGATGGGGAAGACTGAGGAAGG + Intergenic
1174137849 20:48392973-48392995 GAGCTGGGGAAGACCGTAGTGGG + Intergenic
1174479056 20:50818217-50818239 GAGGTGGAGGAGACCATCGAGGG + Exonic
1174553165 20:51375839-51375861 GAGCTGAGGGTGAACCTGGAGGG + Intergenic
1175230273 20:57469449-57469471 GAGCCGGGGGAGCCCATGGCCGG - Intergenic
1176030428 20:63008756-63008778 GAGCTGGGGGAGCAGGAGGATGG + Intergenic
1176151320 20:63592574-63592596 GAGCTGGTGGAGACCATGAGAGG - Exonic
1178340443 21:31781708-31781730 GAGATGGGGAAGACTGGGGATGG - Intergenic
1178491945 21:33057988-33058010 GTGCTGGGGGAGGCCAGGGAAGG + Intergenic
1179839055 21:44058493-44058515 GAAATGGGGAAGACCGTGGGTGG + Intronic
1179880113 21:44290040-44290062 GAGCTGGGGGTCACTGGGGAGGG - Exonic
1180054917 21:45352741-45352763 GAGCCGGAGGAGGCCGAGGAGGG - Intergenic
1181042989 22:20201623-20201645 GGGCTGGGGGAGAGAGTGGCAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183300684 22:37057593-37057615 GGGTTGGGGGAGACTGTGGTGGG - Intronic
1183368192 22:37418164-37418186 GAGATGGGGGAGACAGGGCAGGG + Intronic
1183485520 22:38085996-38086018 GGGCTGGGGGAGGCCAGGGAGGG - Intronic
1183979850 22:41533025-41533047 GAGCTGAAGGAGAGCCTGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184246143 22:43236714-43236736 AGGCTGGGGGAGGCCGGGGAGGG - Intronic
1184412001 22:44331238-44331260 GGGCTGGGGACGACCGGGGAAGG - Intergenic
1184534635 22:45078030-45078052 GAGCCGGGGGAGACTGAGGCGGG + Intergenic
1184899794 22:47438536-47438558 GAGCTGGGGAAGGCCATGCAGGG - Intergenic
1185043839 22:48518967-48518989 GAGCTGTCGGACACCCTGGAGGG + Intronic
1185191464 22:49439366-49439388 GAACTTTGGGAGACCGAGGAGGG - Intronic
951486744 3:23221442-23221464 GAGCTGGGGGAAAATGGGGAAGG - Intronic
951931146 3:27968542-27968564 GAGCTGGGGGAAACCCAGTAAGG - Intergenic
952139272 3:30459839-30459861 GATCTGGGGGAGTCCAGGGATGG + Intergenic
952195775 3:31074002-31074024 GAGGTGGGGAAGACCAGGGATGG - Intergenic
953154172 3:40353864-40353886 GAGATGGGGAAGACTGTGGATGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954419549 3:50411437-50411459 GAGCTGGGGGAGAGTGAGCATGG - Intronic
955956186 3:64292653-64292675 GAGCTAGTGGAGACAGTGCATGG + Intronic
956129133 3:66038208-66038230 GAGCTGGGGGTGACGGTGCTGGG - Exonic
956774060 3:72550359-72550381 AAGCTGGGGGAGGCAGGGGATGG - Intergenic
956874275 3:73446677-73446699 AAGCTGAGGAAGAACGTGGATGG + Intronic
959210334 3:103370670-103370692 GCGCTGTGGGAGGCCGAGGAGGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960350875 3:116591133-116591155 CAGCTGGGGGAGAACGGGCACGG + Intronic
960482740 3:118213235-118213257 GAGCTGGGGGCCAACGTGCAAGG - Intergenic
960659270 3:120040784-120040806 GAGCAGGGGAAGACAGTGTAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962023839 3:131527055-131527077 GAGCTGGGGGACACCCGGGCCGG + Intergenic
962967287 3:140366646-140366668 GAGCTGGTGCAGAGAGTGGAGGG - Intronic
963160616 3:142148170-142148192 GATCTCGGGGAGACAGGGGAAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965546530 3:169922061-169922083 GAGTTGAGGAAGACTGTGGAAGG + Intronic
966519437 3:180856558-180856580 GAACTTTGGGAGACCGAGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966916576 3:184587591-184587613 GGGCAGGGAGAGACGGTGGAGGG - Intronic
967639700 3:191847111-191847133 AAGCTGGGCCAGACTGTGGAGGG - Intergenic
967997796 3:195179960-195179982 GTGTTGGGGGAGACAGTGGGAGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969479787 4:7441727-7441749 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479800 4:7441756-7441778 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479813 4:7441785-7441807 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479826 4:7441814-7441836 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479839 4:7441843-7441865 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479852 4:7441872-7441894 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479865 4:7441901-7441923 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479878 4:7441930-7441952 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479891 4:7441959-7441981 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479912 4:7442017-7442039 GGGCTGGGGGAGGGGGTGGATGG - Intronic
969479946 4:7442104-7442126 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479959 4:7442133-7442155 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479979 4:7442191-7442213 GGGCTGGGGGAGGGGGTGGATGG - Intronic
969480001 4:7442249-7442271 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480066 4:7442423-7442445 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480091 4:7442481-7442503 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480104 4:7442510-7442532 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480135 4:7442597-7442619 GGGCTGGGGGAGGGGGTGGATGG - Intronic
969480147 4:7442626-7442648 GAGCTGGGGGAGGGGGTGGAGGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971107543 4:23543252-23543274 GAGATGGGGGAGAACGAGGCCGG + Intergenic
971295541 4:25386454-25386476 GAGCTTTGGGAGGCCGAGGAGGG - Intronic
972159418 4:36204742-36204764 GCACTGTGGGAGACCGAGGAGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974042008 4:56865528-56865550 GCGCTGTGGGAGACTGAGGAGGG - Intergenic
974446496 4:61990367-61990389 AAGATTGGGGAGACTGTGGATGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975779645 4:77824786-77824808 GAGATGGGAGAGACAGAGGAGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980122529 4:128742720-128742742 GAGCTTTGGGAGACCGAGGTGGG + Intergenic
981693114 4:147531562-147531584 AAGCTGGGGGAGAAATTGGATGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984157101 4:176206643-176206665 GTGCTGGGGGATACTGTGGAAGG - Intergenic
984212613 4:176868935-176868957 GAGATGGGGAAAACCATGGACGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984962734 4:185113283-185113305 GGGCTGGGGAAGACCATGGAAGG - Intergenic
985646016 5:1085098-1085120 GGGCTGGGTGTGACCGTGGCGGG - Intronic
985909849 5:2870501-2870523 GAGCTGTGGAAGAGAGTGGAGGG + Intergenic
986062753 5:4207431-4207453 GAGGTGGGGGAGACAGAGGGAGG - Intergenic
986114607 5:4759918-4759940 GAGCTTTGGGAGACCGAGGCAGG - Intergenic
987281418 5:16417830-16417852 GAGCTGGGGAAGGCCATGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991058326 5:62343570-62343592 GAGATGGGGGAGTCATTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992054651 5:72976453-72976475 GAGCTTTGGGAGACTGTGGCGGG - Intronic
992320018 5:75604621-75604643 GAGCTTTGGGAGACTGAGGAAGG - Intergenic
993651372 5:90526742-90526764 GAGCTGGGGGAGGAGGTGCATGG + Intronic
997131362 5:131279692-131279714 GAACTGGGGGAGAAGGTAGAGGG - Intronic
997379099 5:133422417-133422439 GGGCTTGGTGAGACAGTGGAGGG + Intronic
997439410 5:133898785-133898807 GTCCTGGGGGAGGCAGTGGAAGG - Intergenic
997475074 5:134138075-134138097 GAGTTGGGGGACACCGTGGGGGG - Exonic
997516159 5:134491385-134491407 GAGCTGGGGGAGAAAAAGGAAGG - Intergenic
997978350 5:138453700-138453722 GGGCTGGGGCTGACTGTGGACGG - Intergenic
998149106 5:139746940-139746962 GAGCTGCGGACGACCGTGGAGGG - Intergenic
1000521512 5:162300126-162300148 GCGGTGGGGGAGGCTGTGGATGG + Intergenic
1001687199 5:173602739-173602761 GAGCTGGGGAAGGCCATGAAGGG - Intergenic
1002028364 5:176410979-176411001 GAGCTGCGGGAGAGAGTGGAGGG - Intronic
1002080800 5:176736369-176736391 GAGCTTGGGGAGGCCGAGGTGGG - Intergenic
1002130474 5:177078450-177078472 GAGCTGGGGGTGCCAGTGGGTGG + Intronic
1002437297 5:179239395-179239417 GAGCTGGGGAAGGCCGAGGGTGG + Intronic
1002580983 5:180209269-180209291 GAGCTGCGGGAGCCCGCGGGCGG + Intergenic
1003923409 6:10855303-10855325 GAGATGGGGAAGGCTGTGGAAGG - Intronic
1006193948 6:32226130-32226152 GAGCTTTGGGAGGCCGAGGAAGG - Intergenic
1007776203 6:44225792-44225814 GAGGTGGGAGAGCCCGTGGAAGG + Intronic
1008160401 6:48068904-48068926 GGGCGCGGGGAGACCGGGGAGGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009961956 6:70534071-70534093 GAGCTGGGGAAGATGGGGGATGG + Intronic
1011149497 6:84254589-84254611 GAACTGGGGGACACTTTGGAGGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013533782 6:111044522-111044544 GAACTGAGGGAGATCATGGAAGG - Intergenic
1014516483 6:122385082-122385104 GTGCTTTGGGAGACCGAGGAGGG + Intergenic
1015509297 6:134022093-134022115 GAGCTGGGTGAGATAATGGAGGG + Intronic
1016329918 6:142945310-142945332 GGGATGGGGGAGACCGCGGGAGG - Intergenic
1016382651 6:143500502-143500524 GAGATGGAGAAGACCGTGGGTGG + Intronic
1016713227 6:147196699-147196721 GAGCTGGGGTAGAAGGTGGTGGG + Intergenic
1016759413 6:147720476-147720498 GAGCTGGGGGAGACCGTGGAAGG - Intronic
1017711712 6:157174904-157174926 GAGCTGGGGGACATTGGGGAAGG - Intronic
1018740586 6:166725634-166725656 GAGCTGGGTGAGCCAGTGGGGGG + Intronic
1019304089 7:324337-324359 GAGCTGGGGGAGGCTGGGGTGGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019622601 7:1999915-1999937 GAGTTGGGGTACTCCGTGGAGGG - Intronic
1019643291 7:2115961-2115983 GCGCTGCCGGAGACGGTGGAGGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020081909 7:5290870-5290892 TGGCTGGGCGTGACCGTGGAGGG - Intronic
1020101202 7:5395197-5395219 GGGCTGGGGGACACCCTGCAGGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022528308 7:31052283-31052305 GAGCAGGGGGAGGCGGTGGTCGG + Intergenic
1024061650 7:45703027-45703049 GGGCTGGTGGAGCCTGTGGATGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026388692 7:69878037-69878059 GGGCTGGGGTAGACGGTGGGGGG + Intronic
1026469871 7:70686009-70686031 GAGCTGGGGGAGATGGTGCTGGG - Intronic
1026564904 7:71481700-71481722 CAGCTGTGGGAGAACCTGGAGGG - Intronic
1029275599 7:99402273-99402295 CAGCTGGGGGAGGCCTTGAAGGG - Intronic
1029378795 7:100199242-100199264 GAGCTAGGGGAGAACGTGCATGG - Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035171893 7:157021640-157021662 GAGCTGGGGGGCACCGCGCAAGG - Intergenic
1036823172 8:11955771-11955793 GGGCTGGGGGAGCCGGCGGAGGG + Intergenic
1037036098 8:14169269-14169291 GAGCAGGGGGAGACAGTAGCTGG - Intronic
1037316463 8:17604038-17604060 GAGGTGAGGCAGACCATGGAGGG + Intronic
1037506786 8:19538637-19538659 GAACTGAGGGAGACCGGGGGAGG + Intronic
1037914821 8:22766632-22766654 GAGCTGTGGGAGCCAGTGGAGGG + Intronic
1038076670 8:24083464-24083486 GAGGTCCGGGAGACCCTGGAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038634137 8:29271851-29271873 GGCCTGGGGGAGAACGTGGAAGG + Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039197175 8:35045636-35045658 GAGCTAGGGCAGACAGTGGATGG + Intergenic
1039971695 8:42326054-42326076 AAGCTGTTGGAGGCCGTGGAGGG - Exonic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042819749 8:72916948-72916970 GAGATGGGGCAGACCATGGGTGG + Intronic
1045071313 8:98507292-98507314 GAACTGGGGAAGACTGTGGGTGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046677277 8:117124054-117124076 AAGCTGGGGAAGAGTGTGGATGG + Intronic
1047443984 8:124903283-124903305 GAGCTGGGGGACACCGGGGTAGG + Intergenic
1047459521 8:125049136-125049158 GAGTTGGGAGCGACCATGGATGG - Exonic
1048974717 8:139664740-139664762 GAACTGGGCAAGACCCTGGAGGG - Intronic
1049087113 8:140487402-140487424 GTGCTTTGGGAGACCGAGGAGGG - Intergenic
1049786297 8:144452442-144452464 GAGCTGATGGAGATCCTGGATGG - Exonic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050917699 9:11158269-11158291 GAGGTGGGGGAGACCCCTGAGGG + Intergenic
1051679556 9:19593445-19593467 GGGCTGAGGGAGACAGGGGAGGG + Intronic
1053122084 9:35555180-35555202 GAGCTGGGAAAGGCTGTGGAGGG - Exonic
1054830245 9:69616918-69616940 GAGCTGGGGAAGGCCATGAAGGG + Intronic
1056472430 9:86918917-86918939 GACCTGGGGCTGACCCTGGAAGG + Intergenic
1059819690 9:117958031-117958053 GAGCTGGGGCACACGATGGATGG + Intergenic
1060007224 9:120011292-120011314 GAGCTGGGGAAGGCTGTGAAGGG - Intergenic
1060997199 9:127881433-127881455 GAGCTGGGAGAGAATGAGGAAGG + Intergenic
1061056294 9:128224645-128224667 GAGCTGGGGGAGCTCTTGGTGGG - Intronic
1061256057 9:129454526-129454548 GAGGTGGTGGAGACGGTGGGTGG + Intergenic
1061287232 9:129631031-129631053 GAGCGGGGGAAGACTGTGGAAGG - Intronic
1061326429 9:129867477-129867499 GAGCAGGGGGAGCCAGAGGAAGG + Intronic
1061809366 9:133153549-133153571 GAGCTGGGGGTTGCCATGGATGG - Exonic
1061860961 9:133468621-133468643 AAGCTCGCGGAGACCCTGGAGGG + Exonic
1061989534 9:134151316-134151338 GAGATGGGAGGGACCGTGCATGG + Intronic
1062019141 9:134308096-134308118 GAGCGGGTGAGGACCGTGGAGGG + Intergenic
1062168226 9:135119589-135119611 GGGGTGGGGGAGACGGTGGGAGG - Exonic
1062169580 9:135127475-135127497 GGGCTGTGGGAGCCCCTGGAGGG - Intergenic
1062282157 9:135756983-135757005 GAGGTGGGGGAGGCTGGGGAGGG - Intronic
1062631882 9:137466776-137466798 GAGTTGGTGGAGACGGTGGTGGG - Intronic
1062631908 9:137466874-137466896 GAGTTGGTGGAGACGGTGGTGGG - Intronic
1062631921 9:137466923-137466945 GAGATGGTGGAGACGGTGGTGGG - Intronic
1062631934 9:137466972-137466994 GAGATGGTGGAGACGGTGGTGGG - Intronic
1062631956 9:137467070-137467092 GAGTTGGTGGAGACGGTGGTGGG - Intronic
1062638691 9:137505708-137505730 GAGTGCTGGGAGACCGTGGAGGG + Exonic
1062657543 9:137612062-137612084 GGGTTGGGGGAGACAGTGGCAGG - Intronic
1062671412 9:137712054-137712076 GAGGTGGGGGCAACCCTGGAGGG - Intronic
1186496132 X:10014545-10014567 GAGCTGGGGGAGCCCGCGGCCGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189175511 X:38953281-38953303 GAGCTGGGGGAGGGGATGGAGGG + Intergenic
1189605394 X:42672379-42672401 CAGCTGGGGCAGTCCCTGGAAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1196828308 X:119758164-119758186 GCGCTTTGGGAGACCGTGGCTGG + Intergenic
1197324412 X:125074434-125074456 GAGCTGGGGAAGATTGTAGATGG - Intergenic
1198158177 X:133983471-133983493 GAGCTGGGGGAGAGCAAGGGAGG + Intronic
1198275469 X:135094823-135094845 GGGCTGGGGGAGGCTGTGGCAGG - Intergenic
1198311048 X:135425874-135425896 GGGCTGGGGGAGGCTGTGGCAGG + Intergenic
1198441548 X:136668213-136668235 GAGCAGGAGGAGCCCTTGGAAGG - Intronic
1200182606 X:154159913-154159935 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200188260 X:154197027-154197049 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200193910 X:154234167-154234189 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200199665 X:154271971-154271993 CAGCTTCGGGAGACAGTGGATGG - Intronic
1200241296 X:154495766-154495788 GAGCTGGGGAAGGCCATGAAGGG - Intergenic
1201798801 Y:17930593-17930615 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1201802752 Y:17975364-17975386 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1202360102 Y:24099209-24099231 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1202510675 Y:25570905-25570927 TGGCTGGAGCAGACCGTGGAAGG + Intergenic