ID: 1016761511

View in Genome Browser
Species Human (GRCh38)
Location 6:147742678-147742700
Sequence GAAGTTGGACAGTTGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016761504_1016761511 28 Left 1016761504 6:147742627-147742649 CCTTTCTCCATGGGCTGAAGGGG No data
Right 1016761511 6:147742678-147742700 GAAGTTGGACAGTTGGACATTGG No data
1016761508_1016761511 -7 Left 1016761508 6:147742662-147742684 CCAGTTAAGAACTAACGAAGTTG No data
Right 1016761511 6:147742678-147742700 GAAGTTGGACAGTTGGACATTGG No data
1016761507_1016761511 21 Left 1016761507 6:147742634-147742656 CCATGGGCTGAAGGGGGCAGTAC No data
Right 1016761511 6:147742678-147742700 GAAGTTGGACAGTTGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016761511 Original CRISPR GAAGTTGGACAGTTGGACAT TGG Intergenic
No off target data available for this crispr