ID: 1016769743

View in Genome Browser
Species Human (GRCh38)
Location 6:147835796-147835818
Sequence GGAGGTGATGCGGGTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016769743_1016769750 12 Left 1016769743 6:147835796-147835818 CCAGAAGGACCCGCATCACCTCC No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data
1016769743_1016769748 2 Left 1016769743 6:147835796-147835818 CCAGAAGGACCCGCATCACCTCC No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016769743 Original CRISPR GGAGGTGATGCGGGTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr